ID: 928603927

View in Genome Browser
Species Human (GRCh38)
Location 2:32926851-32926873
Sequence CAGGGGAGGAATGCTGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928603927_928603937 19 Left 928603927 2:32926851-32926873 CCCCCATCAGCATTCCTCCCCTG No data
Right 928603937 2:32926893-32926915 AGAATGTGCTTCTTTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928603927 Original CRISPR CAGGGGAGGAATGCTGATGG GGG (reversed) Intergenic
No off target data available for this crispr