ID: 928606108

View in Genome Browser
Species Human (GRCh38)
Location 2:32946758-32946780
Sequence CCCGTGGGTCGCCGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928606108_928606118 0 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606118 2:32946781-32946803 GGCAACCCCAGTGGATGTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 230
928606108_928606117 -3 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606117 2:32946778-32946800 GGGGGCAACCCCAGTGGATGTGG 0: 1
1: 0
2: 0
3: 14
4: 168
928606108_928606125 18 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606125 2:32946799-32946821 GGAGGGTGGCGGCGCGCCTTCGG 0: 1
1: 0
2: 0
3: 14
4: 105
928606108_928606119 1 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606119 2:32946782-32946804 GCAACCCCAGTGGATGTGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 221
928606108_928606126 19 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606126 2:32946800-32946822 GAGGGTGGCGGCGCGCCTTCGGG 0: 1
1: 0
2: 1
3: 5
4: 70
928606108_928606124 7 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606124 2:32946788-32946810 CCAGTGGATGTGGAGGGTGGCGG 0: 1
1: 0
2: 3
3: 87
4: 700
928606108_928606114 -9 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606114 2:32946772-32946794 ACCCACGGGGGCAACCCCAGTGG 0: 1
1: 0
2: 2
3: 4
4: 90
928606108_928606120 4 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606120 2:32946785-32946807 ACCCCAGTGGATGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928606108 Original CRISPR CCCGTGGGTCGCCGAGGCGG AGG (reversed) Intergenic
900291526 1:1925673-1925695 CCCGTGGGTCGGAGAGCCCGTGG - Intronic
900793998 1:4696588-4696610 CCGGGGGGTGGCCAAGGCGGTGG + Intronic
901230125 1:7637181-7637203 CCCGTGGGAGGCCAAGGTGGCGG - Intronic
901628934 1:10638914-10638936 CCCGCGGGTGGCCCTGGCGGCGG - Exonic
902199526 1:14823156-14823178 CCCATGTGTGGCCGAGGCGACGG - Intronic
902313621 1:15600888-15600910 CACTTGGGAGGCCGAGGCGGGGG - Intergenic
913565645 1:120069733-120069755 CCCCTGGGTGCCCAAGGCGGCGG - Intergenic
913632484 1:120723820-120723842 CCCCTGGGTGCCCAAGGCGGCGG + Intergenic
914286241 1:146229107-146229129 CCCCTGGGTGCCCAAGGCGGCGG - Intergenic
914547269 1:148679849-148679871 CCCCTGGGTGCCCAAGGCGGCGG - Intergenic
914619234 1:149390494-149390516 CCCCTGGGTGCCCAAGGCGGCGG + Intergenic
915238398 1:154502247-154502269 ACCGTGGCTCTCGGAGGCGGCGG + Intronic
922250555 1:223845725-223845747 CCGGAGGGTCGCGGATGCGGGGG + Exonic
924421878 1:243917352-243917374 CCCGCGGGCCCCCGAGGCCGGGG + Intergenic
1063298112 10:4826470-4826492 CCCGGGCGTCGGCCAGGCGGAGG - Intronic
1070865221 10:79704509-79704531 CCCCTGGGTGGGCGAGGCTGGGG + Intronic
1070879012 10:79842640-79842662 CCCCTGGGTGGGCGAGGCTGGGG + Intronic
1070947883 10:80408430-80408452 CCCGGAGGTCGGCGAGTCGGGGG + Intronic
1071632119 10:87226730-87226752 CCCCTGGGTGGGCGAGGCTGGGG + Intronic
1071645572 10:87358949-87358971 CCCCTGGGTGGGCGAGGCTGGGG + Intronic
1083563100 11:63690002-63690024 ACTGTGGGAGGCCGAGGCGGGGG - Intronic
1084003899 11:66313436-66313458 CCAGGGGGTCGCGGAGGGGGCGG - Intergenic
1084567568 11:69940066-69940088 CCCGTGGATAGCCGAGGCCTGGG + Intergenic
1085296719 11:75435547-75435569 CCTGTGGGCCCCCGAGGGGGTGG - Exonic
1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG + Intergenic
1094041110 12:26122617-26122639 CCCGGGGGGCGGCGCGGCGGCGG - Exonic
1095272359 12:40234619-40234641 ACTTTGGGACGCCGAGGCGGGGG - Intronic
1095989283 12:48023157-48023179 TCCCTGGGTCGCCAAGCCGGAGG + Intronic
1100298521 12:93285351-93285373 ACCTTGGGAGGCCGAGGCGGCGG + Intergenic
1104927652 12:132321967-132321989 CCCCTTGGGGGCCGAGGCGGGGG - Intronic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1114292601 14:21301008-21301030 CCTGCGGGTCGCGGAGGAGGCGG + Exonic
1117954368 14:61111284-61111306 CCCGTGGTGGGCGGAGGCGGTGG + Intergenic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1120303520 14:82738110-82738132 ACTTTGGGTGGCCGAGGCGGGGG - Intergenic
1122969853 14:105148082-105148104 CCCGGCGGTCGCAGAGGCAGCGG + Intronic
1132116265 15:99138555-99138577 ACCTTGGGAGGCCGAGGCGGTGG - Intronic
1132677519 16:1126817-1126839 CCCGAAGGTCCCCGAGGAGGGGG + Intergenic
1133286253 16:4692214-4692236 CCCGTGGGACGCAGGGGCAGAGG - Intergenic
1135434973 16:22420715-22420737 CCCGTCTGTCTCCAAGGCGGAGG + Intronic
1137019884 16:35414703-35414725 CCCGTGGGTGGACGGGGCGGGGG - Intergenic
1141085924 16:81095864-81095886 CCTGCGGGACACCGAGGCGGGGG - Intronic
1141513440 16:84527136-84527158 CCCGGGGCTCTCCGAGGCTGTGG - Intronic
1141527015 16:84618133-84618155 CCCATTGGCCGCCCAGGCGGCGG + Intergenic
1142509695 17:385894-385916 CCCGAGGGTCCCCGAGGTCGGGG + Intronic
1143036062 17:3999408-3999430 ACCTTGGGAGGCCGAGGCGGGGG + Intergenic
1143627796 17:8121243-8121265 CCCGTGTGTCCCCGAGCCAGGGG - Exonic
1144107209 17:11997171-11997193 CCCGCGGGGCGCAGAGGCGCAGG + Intronic
1144666298 17:17104685-17104707 CTCGTGGGTGGCTGAGGGGGAGG - Intronic
1147879674 17:43645855-43645877 GCAGTGGGGCGCGGAGGCGGAGG - Intronic
1148437479 17:47694874-47694896 CCTGTGGGTGGCGGAGGGGGGGG + Intronic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1151703144 17:75753879-75753901 CCCGTGGGGCGCCTCGGCGTCGG - Exonic
1152696770 17:81801531-81801553 CCTGTGGGTAGCAGAGGCTGAGG + Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1154133004 18:11752017-11752039 CCAGCGGGTCCCCGAGGGGGCGG - Intronic
1161038364 19:2097532-2097554 CCCGTGGGTCTCCGAGGCTCTGG - Intronic
1161487223 19:4542926-4542948 CCCGGGGGTCTCCGAGGTGCCGG - Exonic
1163157958 19:15449477-15449499 CCCAGGGGTCGCAGAGGTGGGGG + Intronic
1163552647 19:17974158-17974180 CCCGCCGGTGGCCCAGGCGGTGG - Exonic
1164611914 19:29638162-29638184 CCTTTGGGAGGCCGAGGCGGGGG + Intergenic
1165065854 19:33227194-33227216 CTGGTGGGACGCCGAGGGGGAGG + Intergenic
1166975148 19:46601448-46601470 CTGGGGGGTCGCCGAGGCTGCGG + Intronic
1167269368 19:48498876-48498898 CTCGGGGGGGGCCGAGGCGGGGG + Exonic
1167342705 19:48925340-48925362 ACTGTGGGAGGCCGAGGCGGGGG - Intergenic
1168292911 19:55365783-55365805 CTCCTGGGTCCCCGAGGAGGAGG - Exonic
927800521 2:26094801-26094823 ACCTTGGGTGGCTGAGGCGGGGG - Intronic
927982145 2:27380781-27380803 CCCGTGCGTCTCTGCGGCGGCGG - Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
929775383 2:44928345-44928367 GCCGGGGGTCGGGGAGGCGGAGG - Intergenic
929787236 2:45001580-45001602 CCCGATGAGCGCCGAGGCGGCGG - Intergenic
931052413 2:58428839-58428861 CGCCTGGGTCCCGGAGGCGGTGG - Intergenic
931348867 2:61470922-61470944 CCGGAGGGGCGCCGAGGCGCCGG + Intergenic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
932896688 2:75647010-75647032 CCCGTGGGACGCCGGGTTGGGGG + Intronic
933428101 2:82139136-82139158 CACTTGGGAGGCCGAGGCGGTGG - Intergenic
944457450 2:199910558-199910580 ACTGTGGGAGGCCGAGGCGGAGG - Intergenic
946921422 2:224585150-224585172 CCCCTGGGCAGCCGCGGCGGCGG + Exonic
948116016 2:235494604-235494626 CCCGCGGGCCGCCGAGCCCGGGG - Exonic
948193209 2:236075970-236075992 AGCGTGGGTCACCCAGGCGGAGG + Intronic
1170204692 20:13785296-13785318 CCCGCGGGGCGGCGGGGCGGCGG + Intronic
1170617809 20:17968492-17968514 CCCGAGAGGCGCCCAGGCGGCGG - Intronic
1170821386 20:19758290-19758312 CCCGCAGGTCCCGGAGGCGGGGG - Intergenic
1175564549 20:59962725-59962747 CCTGTGGGTTCCCGAGGTGGTGG + Intronic
1176005490 20:62860630-62860652 CCTGAGGGTCGCCAAGGGGGCGG + Intronic
1176155494 20:63618048-63618070 CCCTTGGGACGCCGTGGCCGCGG - Intronic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1177476312 21:21628356-21628378 ACTTTGGGTGGCCGAGGCGGGGG - Intergenic
1178992783 21:37368141-37368163 CCCCAGGGCCGCCGAGGCAGCGG - Intronic
1179053873 21:37914399-37914421 CCTGGGGGCCGCCGAGGTGGTGG - Intronic
1179104266 21:38384134-38384156 CCTGGGGGTGGGCGAGGCGGCGG - Intronic
1181631969 22:24156228-24156250 CGCCTGGTGCGCCGAGGCGGGGG - Intronic
1182648634 22:31831703-31831725 CCTTTGGGAGGCCGAGGCGGGGG - Intronic
1182869073 22:33629952-33629974 CCTTTGGGAGGCCGAGGCGGCGG + Intronic
1185037840 22:48489177-48489199 CCCGTGGGGGGCCCAGGCTGCGG + Intergenic
1185315753 22:50178455-50178477 CCCGTGGGCCGCTGTGGCTGTGG - Intronic
1185397701 22:50601085-50601107 CCCGGGGGTCACTGAGGCTGGGG - Intronic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
950409299 3:12824662-12824684 ACTGTGGGTGGCCGAGGTGGTGG + Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
955660635 3:61295254-61295276 ACTGTGGGAGGCCGAGGCGGGGG - Intergenic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
962198163 3:133380668-133380690 CCTGTGGGTCACCGTGGTGGGGG - Exonic
967723937 3:192844139-192844161 CCCGTGGGCTGGCGAGGCTGCGG - Intronic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
976431415 4:84966528-84966550 CCCGAGGAGCGCCGAGGCTGAGG - Intergenic
983923437 4:173371265-173371287 CCCGTTCCCCGCCGAGGCGGCGG - Exonic
985772944 5:1824502-1824524 CCCGGGGGTCACTGAGGCAGGGG + Intergenic
990954875 5:61331782-61331804 CTCGTGGGTCGCAGCGGGGGAGG - Intergenic
991298164 5:65103019-65103041 CCCGGCGGCCGCCGAGGCGAGGG - Intergenic
996379037 5:122845509-122845531 CCCGCGGGGCCCCGAGGCTGCGG - Exonic
997265987 5:132495908-132495930 CCCATGGGGCCCCGAGGCCGGGG + Intergenic
1002061722 5:176629564-176629586 GCAGGGGGTCACCGAGGCGGCGG - Exonic
1002835081 6:859140-859162 CCCGTGTGTCACCGAGGAGAGGG + Intergenic
1003257924 6:4490121-4490143 CCAGTGGGTCCCCGAGGGTGGGG + Intergenic
1005533588 6:26733119-26733141 TCGGTGGGAGGCCGAGGCGGGGG + Intergenic
1005535062 6:26746557-26746579 TCGGTGGGAGGCCGAGGCGGGGG - Intergenic
1005537207 6:26768535-26768557 TCGGTGGGAGGCCGAGGCGGGGG - Intergenic
1006171547 6:32096153-32096175 CCCGGGGGCTGCCGAGGCCGCGG - Intronic
1007429942 6:41770903-41770925 CCCTTGGGGAGCCGCGGCGGCGG + Exonic
1008598388 6:53065503-53065525 CCCGTTGCCAGCCGAGGCGGGGG - Intronic
1012003234 6:93680753-93680775 CACTTGGGAGGCCGAGGCGGCGG - Intergenic
1013048815 6:106512361-106512383 GCCGTAGGTCGGGGAGGCGGAGG + Exonic
1013231383 6:108164840-108164862 CCCCTGGGACGCCCAGGCGGAGG + Intronic
1016273249 6:142315583-142315605 CCTTTGGGAGGCCGAGGCGGCGG + Intronic
1016326284 6:142905885-142905907 CCTTTGGGAGGCCGAGGCGGGGG + Intronic
1019298330 7:290560-290582 GCCGTGGGGCGCAGAGGCGGAGG - Intergenic
1020673926 7:11156548-11156570 ACTGTGGGAGGCCGAGGCGGCGG + Intronic
1022398153 7:30009475-30009497 ACCTTGGGACGCTGAGGCGGGGG - Intergenic
1022719241 7:32928002-32928024 CCATTGGGAGGCCGAGGCGGTGG - Intergenic
1029839203 7:103344482-103344504 GCCCAGGGTTGCCGAGGCGGAGG + Intronic
1034567883 7:151930021-151930043 CCCGTGGGCTCCCGAGGTGGTGG + Intergenic
1037162145 8:15786698-15786720 ACTTTGGGTGGCCGAGGCGGTGG + Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038274996 8:26113985-26114007 CGCTTGAGTCGGCGAGGCGGAGG + Intergenic
1038632942 8:29262943-29262965 CTCCTGGGCCGCCGGGGCGGAGG - Intronic
1044858495 8:96498732-96498754 ACTTTGGGTGGCCGAGGCGGTGG - Intronic
1045316078 8:101044729-101044751 CCCGTGGGTCGCCCAGCCTCAGG - Intergenic
1049812771 8:144582868-144582890 CCCGTGGGAAGGCGAGGTGGTGG + Intronic
1051641878 9:19230961-19230983 GCGGGGGGTCGCCGAGGAGGCGG + Intronic
1053434943 9:38068478-38068500 ACCGCAGGACGCCGAGGCGGCGG + Exonic
1060263139 9:122093091-122093113 CCGGTGGGAGGCGGAGGCGGTGG - Exonic
1060855956 9:126915099-126915121 CCCGAGGGCCGCCGAAGCCGGGG + Intronic
1062272140 9:135714459-135714481 CCGGTGGGTCGCGGTGGCCGCGG + Intronic
1062708682 9:137960040-137960062 CCTGAGGGACGCCGGGGCGGGGG + Intronic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1185820612 X:3199695-3199717 CTCAGGGGTGGCCGAGGCGGAGG - Intergenic
1189407092 X:40735295-40735317 CCCGGGAGCCGCCGTGGCGGCGG - Exonic
1190337105 X:49269414-49269436 CCCGCGGGTTGCGTAGGCGGTGG - Intergenic
1200000190 X:153056250-153056272 CCCGGGGGCCCCCGTGGCGGGGG + Intergenic
1200209081 X:154337906-154337928 ACTGTGGGAGGCCGAGGCGGGGG + Intergenic
1200221794 X:154394223-154394245 ACTGTGGGAGGCCGAGGCGGGGG - Intronic