ID: 928606108

View in Genome Browser
Species Human (GRCh38)
Location 2:32946758-32946780
Sequence CCCGTGGGTCGCCGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928606108_928606126 19 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606126 2:32946800-32946822 GAGGGTGGCGGCGCGCCTTCGGG 0: 1
1: 0
2: 1
3: 5
4: 70
928606108_928606118 0 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606118 2:32946781-32946803 GGCAACCCCAGTGGATGTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 230
928606108_928606117 -3 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606117 2:32946778-32946800 GGGGGCAACCCCAGTGGATGTGG 0: 1
1: 0
2: 0
3: 14
4: 168
928606108_928606125 18 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606125 2:32946799-32946821 GGAGGGTGGCGGCGCGCCTTCGG 0: 1
1: 0
2: 0
3: 14
4: 105
928606108_928606114 -9 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606114 2:32946772-32946794 ACCCACGGGGGCAACCCCAGTGG 0: 1
1: 0
2: 2
3: 4
4: 90
928606108_928606124 7 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606124 2:32946788-32946810 CCAGTGGATGTGGAGGGTGGCGG 0: 1
1: 0
2: 3
3: 87
4: 700
928606108_928606119 1 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606119 2:32946782-32946804 GCAACCCCAGTGGATGTGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 221
928606108_928606120 4 Left 928606108 2:32946758-32946780 CCTCCGCCTCGGCGACCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 928606120 2:32946785-32946807 ACCCCAGTGGATGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928606108 Original CRISPR CCCGTGGGTCGCCGAGGCGG AGG (reversed) Intergenic