ID: 928607370

View in Genome Browser
Species Human (GRCh38)
Location 2:32955004-32955026
Sequence GTCCAGCGGGACCACTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928607370 Original CRISPR GTCCAGCGGGACCACTGGAA GGG Intronic
901653976 1:10758826-10758848 GTCCAGCCTGGTCACTGGAAAGG + Intronic
901810963 1:11766582-11766604 GTGCAGCAGGACCTCTGGACCGG + Intronic
902399645 1:16150950-16150972 GTCCAGCAGTACCACTGAAAGGG + Exonic
904291948 1:29492150-29492172 GTCCAGCAGGACCCCTGCAGGGG - Intergenic
909476382 1:76085596-76085618 CTACATCAGGACCACTGGAAGGG + Intronic
912521705 1:110250244-110250266 GTCCAGACAGACCCCTGGAAGGG + Intronic
914947726 1:152081016-152081038 GTCCAGCTGGACCGGTGGAAGGG - Intergenic
915735560 1:158082608-158082630 GTCCAGAGGGAACACTCGAGAGG - Intronic
920697125 1:208189436-208189458 GTCCAGCAGGCCCACCAGAAGGG + Intronic
1066026567 10:31364257-31364279 GTCCAGCTGGACCGGTGGAAGGG - Intronic
1069630578 10:69894918-69894940 CTCCAGGAGGACCCCTGGAAAGG - Intronic
1071334718 10:84591219-84591241 GTCCAAGGGAACCACTGGAGGGG - Intergenic
1073479097 10:103774915-103774937 GTCCAGCTGGGACACCGGAAGGG - Intronic
1075801043 10:125153366-125153388 GTCCAGGGAGACCAAGGGAACGG - Intronic
1077330404 11:1981666-1981688 GTCCAGAGGGACCCGTGGGAAGG - Intronic
1079529029 11:21426873-21426895 GTCCATCTGGAGCACTGGCATGG + Intronic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1085554007 11:77402969-77402991 TTCCAGAGGGAACAGTGGAAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1202813383 11_KI270721v1_random:36845-36867 GTCCAGAGGGACCCGTGGGAAGG - Intergenic
1095088652 12:38084737-38084759 GTCCAGCTGCACACCTGGAATGG - Intergenic
1102491744 12:113293467-113293489 GTCCATCGGGACCACTGCTGGGG + Intronic
1103564409 12:121808265-121808287 GTCCAGCTCGCCCACTGGGAGGG - Exonic
1105866169 13:24461632-24461654 TTCCACTGGGCCCACTGGAAAGG + Intronic
1110626928 13:77662834-77662856 GTCCAGCTGGACCGGTGGAAGGG - Intergenic
1119197547 14:72728397-72728419 GCACAGCGGGACCAATGGCATGG + Intronic
1121649920 14:95550379-95550401 GTCCAGTGGGACCTCTGGCCTGG - Intergenic
1123948797 15:25251646-25251668 CTCCAGGAGGCCCACTGGAATGG - Intergenic
1124393268 15:29278699-29278721 ATCCAGTGGGATAACTGGAATGG - Intronic
1128707972 15:69851335-69851357 GTCCAGCTGTAACACAGGAAGGG + Intergenic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1129907105 15:79196097-79196119 GTGCAGGGGAATCACTGGAATGG - Intergenic
1132149153 15:99447411-99447433 GTCCCGCGGGCCCAGAGGAAGGG - Intergenic
1133442264 16:5830733-5830755 GTCCAGCAGGCACACTGCAATGG - Intergenic
1138829586 16:60359910-60359932 GTCCAGGGGAACCGGTGGAAGGG - Intergenic
1140655085 16:77132150-77132172 GTCCACCGGGATCAGTAGAATGG + Intergenic
1142850118 17:2700769-2700791 GTCCAGCTGTACACCTGGAATGG + Exonic
1143662767 17:8336931-8336953 GTGCAGTGGGACCTCAGGAATGG - Intergenic
1145816013 17:27795587-27795609 GTCCAGAGGGACCCCTGCATGGG - Intronic
1149310040 17:55384716-55384738 ATTCAGCGGGACTACTAGAATGG + Intergenic
1152321772 17:79611758-79611780 TTCCTGGAGGACCACTGGAAAGG + Intergenic
1152417053 17:80169497-80169519 GCCCACCGGGACCTCTGTAATGG - Intergenic
1158634741 18:59146858-59146880 GACCAGCTGGATCACTGGGAGGG - Intronic
1163787206 19:19280962-19280984 GTGCAGCGGGCCCTCTGGGAAGG + Intronic
1167072254 19:47228033-47228055 GCCCAGCCGGGCCACTGGGAGGG - Intronic
928607370 2:32955004-32955026 GTCCAGCGGGACCACTGGAAGGG + Intronic
930008455 2:46916008-46916030 GTCCAGCGGCCCAACTGGAGTGG - Intronic
930025861 2:47028814-47028836 GTGCAGCTTGACCACAGGAAGGG - Intronic
930326212 2:49922168-49922190 GTCCAGCAGCACCACGGGTATGG - Exonic
932063488 2:68529672-68529694 GTCCAGCTGGACCGGTGGAAGGG - Intronic
942591660 2:177552997-177553019 GCGCCGCGGAACCACTGGAACGG - Exonic
943638649 2:190334718-190334740 GTCCAGAGGGAGCACAGGAAAGG + Intronic
948454077 2:238096721-238096743 GCCCAGCAGGACCCCGGGAAGGG + Intronic
1170891376 20:20378887-20378909 GTCCACCAGCACCACTGTAAGGG - Intergenic
1172599351 20:36173300-36173322 GTCCAGCTTCAGCACTGGAAAGG + Intronic
1172892649 20:38278014-38278036 TTGCAGCTGGACCACTGTAAGGG - Intronic
1176362912 21:6013129-6013151 GTCCAGCCGAATCAATGGAATGG - Intergenic
1179456934 21:41506891-41506913 TTCCCGCGGGACCACTGCACAGG + Intronic
1179760606 21:43525416-43525438 GTCCAGCCGAATCAATGGAATGG + Intergenic
1184237164 22:43188960-43188982 CCCCAGCGGGACCGATGGAAGGG - Intergenic
1184435696 22:44473774-44473796 GTCCAGTGGGGCCACGGGAGTGG + Intergenic
959565335 3:107827104-107827126 GTGCAGCGAGTCCGCTGGAAGGG - Intergenic
968709995 4:2107651-2107673 GGCCAGGGGGACCACTGGCCTGG + Intronic
969038094 4:4272339-4272361 ATCAAGGGGGACAACTGGAATGG - Intronic
979931135 4:126632182-126632204 GTCCAGTGGGTCCTCTAGAAGGG - Intergenic
985951332 5:3223460-3223482 GCCCAGAGGGAACACTGGCATGG - Intergenic
986327376 5:6686254-6686276 GATCAGCGGGACCACTGTAAGGG + Intergenic
989609162 5:43274759-43274781 GTCCACTGGGACTTCTGGAATGG - Intronic
991120826 5:63011374-63011396 GTCCAGTGAGACCACTGGCTGGG + Intergenic
992927078 5:81599150-81599172 TGCCAGTGGGACCACTGGGAAGG + Intronic
992953070 5:81879688-81879710 GTTCAGCGGGAGCTCGGGAATGG + Intergenic
994053944 5:95394440-95394462 GACCAGAGGGAGCAGTGGAAAGG + Intronic
997500084 5:134367035-134367057 GACCAGCGGGACCACAGAATGGG - Exonic
999861029 5:155646519-155646541 AGCCAGTGGGGCCACTGGAAAGG - Intergenic
1002093364 5:176817420-176817442 GGCCAGCAGGTCCACTGGAGAGG + Intronic
1002687113 5:181021386-181021408 GTCCAGCGAGACCACTGGCTAGG - Intergenic
1005243059 6:23853982-23854004 GTCCAGCTGGAGCGGTGGAAGGG + Intergenic
1007735231 6:43978209-43978231 TTCCAGAGGTACAACTGGAAAGG + Intergenic
1009398785 6:63230544-63230566 GTCCAGCTGGATCGGTGGAAAGG - Intergenic
1015208616 6:130670785-130670807 TTCCAGGGGGACTAGTGGAAAGG - Intergenic
1016673349 6:146733884-146733906 GTCCAGCCATTCCACTGGAAAGG - Exonic
1018330421 6:162721575-162721597 GTCCTGCAGGAAAACTGGAATGG + Intronic
1024063417 7:45715185-45715207 GTCCAGGAGGGCCACTGGGAAGG + Exonic
1025854077 7:65263308-65263330 GTCCAGCTGCACACCTGGAATGG - Intergenic
1027702342 7:81484483-81484505 GTCCAGAGAGACCACTGGTTAGG - Intergenic
1032085536 7:128881566-128881588 GCCCAGGGGGAACACAGGAAGGG - Intronic
1034947856 7:155275324-155275346 GGCCAACTGGACCACAGGAATGG - Intergenic
1037459442 8:19094439-19094461 GTCCTGCCGCTCCACTGGAAGGG + Intergenic
1038373169 8:27012579-27012601 GTCCAGCTGGACCGGTGGAAGGG - Intergenic
1038589903 8:28827383-28827405 GTCCAGAAGGACCACTTGGAAGG + Intronic
1039311489 8:36322106-36322128 GTCCAGCTGGACCGGTGGAGGGG - Intergenic
1044807499 8:96023080-96023102 GTCCAGGGAGCTCACTGGAAAGG - Intergenic
1049880803 8:145061208-145061230 GTCCTGAGGGGCCACAGGAATGG - Intergenic
1050730762 9:8706892-8706914 GTCCAGCGGGGACAGTGGCACGG - Intronic
1052413172 9:28147756-28147778 GTCCAGCTGGACCGGTGGAAGGG + Intronic
1056020441 9:82433338-82433360 GTCCAGGGGGACCAGTGGAAGGG - Intergenic
1056576629 9:87859807-87859829 GTCCAGCTGGACCGGTGGAGGGG - Intergenic
1057071459 9:92103970-92103992 GTCCAGGGGGACTGGTGGAAGGG + Intronic
1058855390 9:109056936-109056958 CTCCAGCTGGACTACTGGAGAGG - Intronic
1061809502 9:133154141-133154163 ACCCAGCGGGACCCCGGGAACGG + Exonic
1185776792 X:2809665-2809687 GACCAGGAGGACCACTAGAATGG - Intronic
1187035690 X:15537202-15537224 GTCCAGCTGGGCAAGTGGAAGGG + Exonic
1187250435 X:17593372-17593394 TTCCAGTGGGCCCACTGGGAAGG + Intronic
1190368494 X:49719613-49719635 ATCCAGGGGGACCACTACAATGG - Intergenic
1190470875 X:50778069-50778091 GTCCAGCTGGAAGACTGGTATGG - Intronic
1190975448 X:55395935-55395957 GTCCAGCAGGAACATTTGAAGGG - Intergenic
1191160878 X:57328939-57328961 GTCCTCCTGGACCACTAGAAGGG + Intronic
1192358182 X:70422899-70422921 GCCCAGCCAGCCCACTGGAAAGG - Intergenic
1195454274 X:105051059-105051081 GTCCTGCAGACCCACTGGAATGG - Intronic
1200182224 X:154157579-154157601 GTCCAGGGGGAGTTCTGGAAAGG - Intronic
1200187878 X:154194693-154194715 GTCCAGGGGGAGTTCTGGAAAGG - Intergenic
1200193528 X:154231833-154231855 GTCCAGGGGGAGTTCTGGAAAGG - Intronic
1200199283 X:154269637-154269659 GTCCAGGGGGAGTTCTGGAAAGG - Intronic
1201293200 Y:12441803-12441825 GACCAGGAGGACCACTAGAATGG + Intergenic