ID: 928607920

View in Genome Browser
Species Human (GRCh38)
Location 2:32961249-32961271
Sequence AGAGCTCGGCAGAGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928607920_928607930 20 Left 928607920 2:32961249-32961271 CCTCCGGGTCTCTGCCGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 928607930 2:32961292-32961314 AGCAGGGAGCTGCGAGGCTGCGG 0: 1
1: 1
2: 0
3: 55
4: 593
928607920_928607927 14 Left 928607920 2:32961249-32961271 CCTCCGGGTCTCTGCCGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 928607927 2:32961286-32961308 ACCCTCAGCAGGGAGCTGCGAGG 0: 1
1: 0
2: 0
3: 14
4: 220
928607920_928607925 3 Left 928607920 2:32961249-32961271 CCTCCGGGTCTCTGCCGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 928607925 2:32961275-32961297 GGAAAGGCAAGACCCTCAGCAGG 0: 1
1: 0
2: 2
3: 28
4: 159
928607920_928607926 4 Left 928607920 2:32961249-32961271 CCTCCGGGTCTCTGCCGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 928607926 2:32961276-32961298 GAAAGGCAAGACCCTCAGCAGGG 0: 1
1: 0
2: 3
3: 26
4: 209
928607920_928607931 26 Left 928607920 2:32961249-32961271 CCTCCGGGTCTCTGCCGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 928607931 2:32961298-32961320 GAGCTGCGAGGCTGCGGTTTAGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928607920 Original CRISPR AGAGCTCGGCAGAGACCCGG AGG (reversed) Intronic
900093307 1:929920-929942 ACAGCTGGCCAGAGACCCAGAGG - Intronic
900299048 1:1967621-1967643 AGGGCACCGCAGAGACCCTGTGG + Intronic
904027610 1:27514284-27514306 ACAGCTGGGCAGGGCCCCGGGGG - Intergenic
905851029 1:41275140-41275162 AAAGCTCGGCAGGAACCCTGGGG - Intergenic
912167425 1:107057267-107057289 AGAGCTCGGCGGAGGCCGGCAGG - Exonic
912376225 1:109212074-109212096 AGAGCTAAGTAGAGACCCTGAGG - Intergenic
912381269 1:109249526-109249548 CGAGCTCTGCAGAGTCGCGGCGG - Intergenic
914666797 1:149839405-149839427 GGGTCTCGGCAGAGACCCAGAGG + Intergenic
914668970 1:149854385-149854407 GGGTCTCGGCAGAGACCCAGAGG - Intronic
921177220 1:212606131-212606153 AGAGCAAGGCAGAGCCCCTGAGG - Intronic
922372987 1:224929861-224929883 AGCGGTCGGCAGAGCCTCGGCGG + Intronic
1063105443 10:2987958-2987980 AGAGCTCGGGAGGGACATGGGGG - Intergenic
1064408901 10:15088605-15088627 AGCGGTCGGCGGTGACCCGGGGG - Intronic
1069840941 10:71339036-71339058 AGAGCAGGGCAGAGACCGGGTGG - Intronic
1071568087 10:86681716-86681738 TGTACTCGGCAGAGACCCTGAGG + Exonic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1075086940 10:119419926-119419948 TGAGCTCTGCAGAGTACCGGGGG + Intronic
1077336885 11:2009298-2009320 GGAGGCCGGCAGAGACCGGGTGG - Intergenic
1083403478 11:62440696-62440718 AGAGATCTGCAGAGAGCCAGAGG + Intronic
1084425455 11:69081629-69081651 AGAGCACGGCAGAGAGCTGAGGG - Intronic
1089138886 11:116270787-116270809 AGAGCTGGGCAGGGCCCGGGTGG + Intergenic
1089452466 11:118607813-118607835 GGAGCTCGGCAGAAACCCGTGGG + Intronic
1202819869 11_KI270721v1_random:64480-64502 GGAGGCCGGCAGAGACCGGGTGG - Intergenic
1093322139 12:17724788-17724810 AGAGAAGGGCAGAGACACGGAGG + Intergenic
1095985350 12:47995612-47995634 AGAGCTGGGCAGAGCCTGGGAGG + Intronic
1103513295 12:121490014-121490036 AGAGCGGGGCAGGGACCCGCCGG + Intronic
1103971795 12:124677275-124677297 AGAGGCCAGCAGAGACCCCGGGG + Intergenic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1113636915 13:111925702-111925724 AGAGCTGGGCAGAGTCGCAGCGG + Intergenic
1113931488 13:113971281-113971303 AGAGCTCGGCAGAGTCACATGGG + Intergenic
1121683471 14:95814123-95814145 TCAGCTCAGCAGAGACCCTGTGG - Intergenic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123937675 15:25201929-25201951 AGCGCCCAGCAGAGACTCGGTGG + Intergenic
1128554785 15:68623941-68623963 AGGGCTGGGCAGAGAGCAGGAGG - Intronic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1128841706 15:70855614-70855636 AGGGCTGGGGAGAGACCCAGGGG + Intronic
1129460338 15:75697246-75697268 AGAGCTAGGGGGAGACCAGGGGG - Intronic
1130655321 15:85788496-85788518 AGAGCCCGGCAGAGAACAGATGG + Intronic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132585276 16:703461-703483 AGAGCTGGGCAGGGCCCTGGTGG + Intronic
1132747856 16:1444392-1444414 AGAGCTGGGCACAGGCCAGGGGG + Exonic
1133055747 16:3144672-3144694 GGAGCTGGGCAGGGACCCAGGGG + Intronic
1135040225 16:19112735-19112757 AGAGCTGGGCAGAAACCAAGGGG - Intergenic
1135114310 16:19712393-19712415 AGAGCTCGGAAGAGAATCTGGGG + Intronic
1138088740 16:54156916-54156938 AGAGGTAGGAAGAGACCCAGAGG - Intergenic
1138572414 16:57884323-57884345 AGAGCTCGGTGGAGACCCCGGGG + Exonic
1140859457 16:79006313-79006335 ACAGCCGTGCAGAGACCCGGGGG + Intronic
1145395480 17:22490740-22490762 AGGGCTGGGCAGAGCCCCTGAGG + Intergenic
1146186851 17:30729810-30729832 AGACCCCAGCAGAGACCAGGGGG + Intergenic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1149411352 17:56410709-56410731 AGAGGTTGGCAGAGAGACGGTGG - Intronic
1152639015 17:81442015-81442037 AGAGCTGGGCAGAGAGAAGGCGG + Exonic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1158381208 18:56932167-56932189 AGGGCTCTGCAGTGACCTGGAGG - Intronic
1161072732 19:2270635-2270657 AAAGCTCGACCGAGACCCCGCGG - Intronic
1162567697 19:11453323-11453345 AGATCTCTGCAGAGAACCTGGGG + Exonic
1162972045 19:14186687-14186709 AGACCCCAGCAGAGACCAGGGGG - Intronic
1164855052 19:31514151-31514173 TGAGCTGTGCAGAGAGCCGGAGG + Intergenic
1167315856 19:48762330-48762352 AGAGGGGGACAGAGACCCGGGGG + Intergenic
1167348964 19:48963257-48963279 AGAGGAGGGCAGAGACCCAGAGG - Intergenic
1167472081 19:49680856-49680878 AGAGGGCGGCAGAGACCAGTGGG - Intronic
925575654 2:5357416-5357438 AGAGCTGGACATAGAGCCGGGGG + Intergenic
926113355 2:10196391-10196413 AGGGATCGGCAGAGACCAGCAGG + Intronic
926251551 2:11157860-11157882 AGAGCCCAGCAGAGCCCTGGAGG - Intronic
927391246 2:22597867-22597889 AGAGATCAGCAGTGACCAGGTGG + Intergenic
928607920 2:32961249-32961271 AGAGCTCGGCAGAGACCCGGAGG - Intronic
934027707 2:88015053-88015075 AGAGGTGGGCAGATACCCTGAGG - Intergenic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
941698612 2:168579688-168579710 AGAGCACAGCAGAGACGGGGAGG - Intronic
942890301 2:180980397-180980419 AGAGCGCGGCGGGGACCCGGCGG - Intronic
943049568 2:182898889-182898911 AGGGGTGGGCAGAGACCTGGAGG + Intergenic
947328364 2:229002263-229002285 ACAGCTTGGCAGAGCCTCGGGGG - Intronic
947792677 2:232876941-232876963 AGAGGCCGACAGAGACCCCGGGG + Intronic
1168914186 20:1472926-1472948 AGAGCCCTGCAGATACCCAGGGG - Intronic
1169468608 20:5863539-5863561 AGAGCTGGCCAGAGACCCTAGGG - Exonic
1173063171 20:39681372-39681394 AGAGCTCAGCAGAGTCCAAGAGG - Intergenic
1173505508 20:43584021-43584043 AGAGCTCCACAGAGACCAGCTGG - Intronic
1173652901 20:44678597-44678619 AGAGCTCAGCTGAGACCTGAAGG + Intergenic
1173823489 20:46032859-46032881 AGAGCTCTTCTGAGACCCTGGGG + Intronic
1173843983 20:46176703-46176725 AGAGCTGGGGACAGGCCCGGAGG + Intronic
1174186509 20:48709983-48710005 AGAGCTCAGCAAAGTCCCAGGGG - Intronic
1176167479 20:63681687-63681709 AGACCTGGGCAGGGACCAGGTGG + Intronic
1176236586 20:64056424-64056446 ACAGCTCGGCAGAGCCCCCAAGG + Intronic
1179817548 21:43917324-43917346 AGGGCTCAGCAGAGACCCGGAGG - Intronic
1180177246 21:46096844-46096866 AGAGTTCGGCATGGACCCAGGGG + Intergenic
1181696075 22:24593296-24593318 GGAGCTCGGCCGAGACGAGGTGG + Intronic
1184427704 22:44422944-44422966 ACAGCCAGGCAGAGACCTGGGGG - Intergenic
1185222191 22:49634669-49634691 AGTGGTCGGCAGAGGCCCGTTGG - Intronic
953705809 3:45229333-45229355 CCAGCTCGGCAGGGACCTGGAGG + Intergenic
956659406 3:71583341-71583363 AGAGCTGGGCCTCGACCCGGGGG + Intronic
959093884 3:101932913-101932935 AGAGCTGGCCAGAGTCCAGGAGG - Intergenic
962783912 3:138748412-138748434 TGAGCTTGGCAGAGACTCAGAGG - Intronic
964107361 3:153053490-153053512 AGAGCTCAGCAGAGACTCTTGGG - Intergenic
969924802 4:10575711-10575733 ATAGCTGGGCAGAGACCCCAAGG + Intronic
975163301 4:71148290-71148312 AGAGCTCGAGAGAGACCAGTGGG - Intergenic
975695317 4:77007212-77007234 GGAGCTGGGAAGAGAGCCGGGGG + Intronic
985720496 5:1486240-1486262 AGAGCTCAGCAGAGCCCTGTGGG - Intronic
989282175 5:39657043-39657065 AGAGCCAGGCAGAAAGCCGGGGG - Intergenic
994029728 5:95127929-95127951 AGAGCTGGGCAGCGACCAGATGG + Intronic
994310151 5:98259849-98259871 AGAGCTGGGCTCAGAACCGGTGG - Intergenic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
996440614 5:123486140-123486162 AGAGCCCGGCAGGAACCCAGTGG + Intergenic
996824320 5:127664332-127664354 AGTGCTGGGCAGAGACGTGGAGG - Intergenic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
999324962 5:150638126-150638148 ATAGCTCAGCAGAGACTAGGAGG - Intronic
1001605736 5:172958743-172958765 GGAGCTCGGGAGCGACCCGGCGG + Intronic
1002099219 5:176849044-176849066 AGAGCGGGGCAGAGACTGGGAGG + Intronic
1003672746 6:8174577-8174599 AGAGGACGGCAGAGGCCCGGAGG + Intergenic
1007379485 6:41478437-41478459 AGAGCCCTGCAGATAACCGGGGG - Intergenic
1011607269 6:89117739-89117761 GGAGCACGGCCGAGGCCCGGCGG - Intronic
1013111731 6:107069924-107069946 AGAGCTCGGGGAAGAGCCGGTGG + Exonic
1018625384 6:165772601-165772623 AGAGTTCGGAAGGGCCCCGGAGG - Intronic
1019641716 7:2106901-2106923 AGACCTGGGCAGGGGCCCGGGGG + Intronic
1019691113 7:2413230-2413252 AGAGTTCCGCACAGACACGGAGG - Intronic
1028136735 7:87230468-87230490 GGAGCTCGGAAGAGGCCTGGAGG + Intergenic
1029460914 7:100693703-100693725 AGGGCTTGGCAGGGGCCCGGGGG + Intergenic
1029605995 7:101599691-101599713 TGGGCTAGGCAGAGTCCCGGGGG - Intergenic
1029734071 7:102455861-102455883 AGAGCCCCGCATAGACCCAGGGG - Exonic
1037923145 8:22822015-22822037 AGAGTTCGGAAGAGAGCCAGGGG + Intronic
1048862919 8:138737095-138737117 ACAGCTCTGCAGGGACCTGGTGG - Intronic
1048945468 8:139443154-139443176 GCAGCTCAGCAGGGACCCGGAGG + Intergenic
1049614686 8:143570978-143571000 AGAGCTCGGCTGCTACCCTGAGG + Exonic
1051198746 9:14593855-14593877 GGATCTCTGCAGAGACCAGGTGG - Intergenic
1053306318 9:36986750-36986772 ACAGCTCGGCAGAGAGGCCGAGG - Intronic
1054872941 9:70066165-70066187 ACAGCTCAGCAGAGACCCAAGGG + Intronic
1055874378 9:80924557-80924579 AGAGCTGGGCAAAGGCCCTGAGG + Intergenic
1056154120 9:83817763-83817785 AGAGCGCGGCTGAGAGCAGGCGG + Intronic
1057829708 9:98397047-98397069 AGTGCTCAGCAGCGACCCAGTGG + Intronic
1059325745 9:113503226-113503248 AGAGCAGGGCTGAGAGCCGGAGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061811852 9:133166932-133166954 AGAGCTGGGCTGAGACCCCTTGG + Intergenic
1062009014 9:134257152-134257174 AGAGCTCCACAGAGAGCCGGTGG - Intergenic
1062383038 9:136296739-136296761 AGTGCCCTGCAGAGACCCAGCGG - Intronic
1203697603 Un_GL000214v1:113211-113233 TCAGCTCAGCACAGACCCGGGGG - Intergenic
1185449885 X:276335-276357 AGTGTCCCGCAGAGACCCGGCGG + Intronic
1195538415 X:106035033-106035055 AGAGTTCAGCAGAAACCCAGAGG - Intronic