ID: 928609868

View in Genome Browser
Species Human (GRCh38)
Location 2:32982467-32982489
Sequence GTGATTAAGCCCACTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928609868_928609874 18 Left 928609868 2:32982467-32982489 CCCAAGACAGTGGGCTTAATCAC 0: 1
1: 0
2: 0
3: 5
4: 141
Right 928609874 2:32982508-32982530 AGTTAATCACCAAGACAGTGGGG 0: 1
1: 40
2: 680
3: 1193
4: 1655
928609868_928609872 16 Left 928609868 2:32982467-32982489 CCCAAGACAGTGGGCTTAATCAC 0: 1
1: 0
2: 0
3: 5
4: 141
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510
928609868_928609873 17 Left 928609868 2:32982467-32982489 CCCAAGACAGTGGGCTTAATCAC 0: 1
1: 0
2: 0
3: 5
4: 141
Right 928609873 2:32982507-32982529 AAGTTAATCACCAAGACAGTGGG 0: 1
1: 39
2: 732
3: 1284
4: 1702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928609868 Original CRISPR GTGATTAAGCCCACTGTCTT GGG (reversed) Intronic
902110290 1:14072715-14072737 GTGATTAAGCAACCTGTCATGGG - Intergenic
903523131 1:23970289-23970311 TTTGTTAACCCCACTGTCTTGGG - Intronic
904953556 1:34263941-34263963 GTGATTAAGAACATGGTCTTAGG + Intergenic
905728725 1:40278727-40278749 GTGATTAAGAGCACAGACTTTGG - Intronic
906038086 1:42765748-42765770 GTTATTAGTCCCACTGTATTGGG - Intronic
906578858 1:46917769-46917791 GTGATTATGACCTTTGTCTTTGG + Intergenic
906654526 1:47537933-47537955 GTGTTTGAGCCCAATTTCTTAGG - Intergenic
907409360 1:54273790-54273812 GTGATGAAGCCCCCTATCCTGGG - Intronic
907950891 1:59182627-59182649 TTGTTTAAGGCCACTGTGTTTGG + Intergenic
910919553 1:92329221-92329243 GAGATTAAGTCCTTTGTCTTCGG + Intronic
911500627 1:98680401-98680423 GAGATTTTCCCCACTGTCTTGGG + Intronic
912889651 1:113515699-113515721 GTGACTAAGCACACAGGCTTTGG - Intronic
913078897 1:115363873-115363895 GTGATTAAGCCCATGTTCTGGGG + Intergenic
916256904 1:162797881-162797903 GTGTTTGAGACCAATGTCTTTGG + Exonic
920255901 1:204654127-204654149 GTGGTTAAGCACACAGACTTTGG - Intronic
922980346 1:229820915-229820937 GTGCTTAAGGCCAATGGCTTGGG - Intergenic
923522506 1:234746647-234746669 GTCATTTAACACACTGTCTTGGG + Intergenic
924850742 1:247827876-247827898 GTGTTTAAGAACAATGTCTTTGG + Intergenic
1068282385 10:54891323-54891345 GTGAGCAAGGCCACTGTATTGGG + Intronic
1068790333 10:61023282-61023304 CTGATCAAGCCCACTGCCTCAGG + Intergenic
1069710121 10:70482650-70482672 GTGATTAAGAACACTGGCTCTGG + Intronic
1085380193 11:76109611-76109633 GTGAATCAGCTCTCTGTCTTTGG - Intronic
1086272629 11:85085793-85085815 GTGTTTAAGGACACTGACTTTGG - Intronic
1086894501 11:92296237-92296259 GTGGTTAAGACCACAGGCTTTGG + Intergenic
1087208335 11:95419941-95419963 GTAATTAAGCACACTAGCTTTGG - Intergenic
1089329881 11:117681802-117681824 GTGATTCTGCCCAGTGCCTTAGG - Intronic
1090304471 11:125678847-125678869 GGGATTAAGCCGCCTGTATTTGG + Intronic
1090834152 11:130441670-130441692 GTGACTTGGCCCACTGTCTTTGG - Intergenic
1091054059 11:132402045-132402067 CTGATTAACCCCACTTACTTGGG - Intergenic
1097241451 12:57578254-57578276 GTGAATCCCCCCACTGTCTTCGG - Exonic
1097334969 12:58371926-58371948 GTGATTAAACCATCTGTGTTAGG + Intergenic
1101651015 12:106677164-106677186 GTGATTAGGCACACAGGCTTTGG - Intronic
1104869821 12:131987004-131987026 GTGATAAAGCCTGCAGTCTTGGG + Intronic
1109201303 13:59434796-59434818 GAGATTATGTCCTCTGTCTTTGG + Intergenic
1110504758 13:76272344-76272366 GAGATTAAGTCCTTTGTCTTCGG - Intergenic
1111734555 13:92121243-92121265 GTGACTAAGCCCATTGGCTCTGG - Intronic
1112205292 13:97318297-97318319 GTGATTAAGAGCAGTGGCTTTGG + Intronic
1117625329 14:57631202-57631224 TTTGTTAACCCCACTGTCTTAGG + Intronic
1119870361 14:78011867-78011889 GTGATTATGACCACTCTCTCTGG - Intergenic
1119934286 14:78576695-78576717 GTGATTAAGCCCAGTGTCAAGGG + Intronic
1120102721 14:80463872-80463894 GTTATTAAGCCCACTATAATTGG - Intergenic
1120702816 14:87716461-87716483 ATGATTCAGCCCACTGTACTAGG + Intergenic
1121043220 14:90767470-90767492 GTGATTAATGCCATTATCTTGGG + Intronic
1123673658 15:22686699-22686721 GTGACTAAGCCCATCGTCTCTGG - Intergenic
1124325660 15:28759690-28759712 GTGACTAAGCCCATCGTCTCTGG - Intergenic
1128753029 15:70162473-70162495 GTGCTTAAGAGCACTGGCTTGGG + Intergenic
1129713248 15:77832293-77832315 GTGCTAAAGCCCCCTGCCTTGGG + Intergenic
1129982229 15:79883843-79883865 GTGCTTAAGATCACTGGCTTTGG - Intronic
1131740380 15:95384151-95384173 TTGATGAAGCCTACTTTCTTTGG + Intergenic
1132066751 15:98737489-98737511 GTGACTCAGCCCACTCTTTTGGG - Intronic
1133526915 16:6614666-6614688 GTGATTTGCCCCACAGTCTTTGG + Intronic
1133660977 16:7917209-7917231 GAGATGAAGCCCTCTGACTTGGG - Intergenic
1134454946 16:14388335-14388357 GTAATTAATCCCACTATTTTTGG + Intergenic
1139426956 16:66887110-66887132 GTGGTTTATCCCACAGTCTTGGG - Exonic
1141914709 16:87087391-87087413 GTGATTGAGCTCAGTCTCTTGGG - Intronic
1142910844 17:3089605-3089627 GAGATTATGCCCTTTGTCTTCGG + Intergenic
1145234425 17:21198700-21198722 GTGATTGAGCCCACTCGCATTGG - Exonic
1145994572 17:29098014-29098036 GTGAAGATGCCAACTGTCTTTGG + Intronic
1146001510 17:29133332-29133354 GTGATTCAGGCCACAGACTTGGG - Intronic
1146771890 17:35576599-35576621 ATGATTAAGAGCACAGTCTTAGG + Intronic
1149605585 17:57922805-57922827 CTGATTTAGACCCCTGTCTTTGG - Intronic
1153103852 18:1505473-1505495 GTTATTAAGGACACTCTCTTTGG - Intergenic
1155458088 18:26043219-26043241 GTGATTAAGAGCACGGGCTTTGG - Intronic
1164605233 19:29593217-29593239 TTGCTTAAGCCCCCTGTCTGTGG - Intergenic
926975933 2:18516812-18516834 GCAATTAAGCCCAAGGTCTTGGG + Intergenic
928609868 2:32982467-32982489 GTGATTAAGCCCACTGTCTTGGG - Intronic
930374462 2:50547623-50547645 TTTATTAAGTCCACTGACTTAGG + Intronic
932220990 2:69998886-69998908 GCCATCAAGCCCACTGTGTTGGG - Intergenic
934087523 2:88522595-88522617 GGGATTAATGCCACTCTCTTGGG - Intergenic
934935949 2:98465590-98465612 CTCATTAAGCCCACTGTATGTGG - Intronic
938576541 2:132609506-132609528 GTAATTAAGAACACTGACTTAGG - Intronic
939181890 2:138813088-138813110 TTCATTCATCCCACTGTCTTAGG + Intergenic
945507144 2:210655896-210655918 GTGATTGAGACCACAGACTTTGG + Intronic
1170962238 20:21035734-21035756 GTGTTTAAGCCCAAAGCCTTTGG - Intergenic
1172831631 20:37840502-37840524 GTGATTAAGAGCATTGGCTTTGG + Intronic
1172937160 20:38628708-38628730 GTGATTAAAACCACAGGCTTTGG + Intronic
1177323837 21:19557355-19557377 GTGATTAAGTGCTCTGTGTTTGG + Intergenic
1183567997 22:38630377-38630399 GTGATTAAGAGCACAGACTTGGG + Intronic
1185045174 22:48525138-48525160 GTGATTAAGTCAAGGGTCTTGGG - Intronic
950896059 3:16451944-16451966 GTGATCAGTTCCACTGTCTTGGG - Intronic
951393053 3:22130430-22130452 GTGCTTTAGCCCACTGTGATGGG + Intronic
954533785 3:51342957-51342979 GTTATCAGACCCACTGTCTTAGG + Intronic
954959516 3:54551629-54551651 GAGATTAATCCCACTGCCTGAGG - Intronic
955962301 3:64353070-64353092 GTGATTTAGTTCTCTGTCTTTGG - Intronic
956031108 3:65039359-65039381 GTGGTTAAGAGCACAGTCTTTGG - Intergenic
956931611 3:74049983-74050005 GTGATTAAGGCCACTGGAGTGGG + Intergenic
959262984 3:104103991-104104013 AGGATAAAGCCCACTGTCATGGG - Intergenic
961157881 3:124696175-124696197 GGTATAAATCCCACTGTCTTGGG - Intronic
963219755 3:142796218-142796240 GTGATTAAGATCACTGGCTCTGG - Intronic
964299375 3:155271149-155271171 GTGATTATGACCTTTGTCTTTGG - Intergenic
965984820 3:174737928-174737950 GGGTTTAAGCCCATTTTCTTTGG + Intronic
966138326 3:176726434-176726456 GTGATTAAGCATACTATGTTGGG + Intergenic
966759035 3:183399354-183399376 GTGATTAAAGCAAATGTCTTAGG - Intronic
972018136 4:34272303-34272325 GTTATTAAGCTCACAGTTTTAGG - Intergenic
972973739 4:44608505-44608527 ATGATTAAGCCCAAACTCTTCGG + Intergenic
982987051 4:162222976-162222998 GTGAATAAGACCACTGATTTTGG + Intergenic
988493428 5:31724665-31724687 TTTGTTAACCCCACTGTCTTGGG - Intronic
989800505 5:45532723-45532745 GAGATTCTGACCACTGTCTTTGG - Intronic
990247470 5:53877430-53877452 GTGACTAATCCCACAGTGTTTGG - Intergenic
992086530 5:73282960-73282982 GTTACTATTCCCACTGTCTTAGG - Intergenic
993227399 5:85184562-85184584 GAGAGTAAGGCCACTGTCCTGGG + Intergenic
994496575 5:100520426-100520448 GAGATTATGACCATTGTCTTTGG - Intergenic
994870971 5:105350519-105350541 GAGATTATGCCCTTTGTCTTTGG + Intergenic
998231073 5:140361765-140361787 GTGATTAAGACCACAGGCTTTGG - Intronic
1000038818 5:157469531-157469553 GCAATTAAGCCCACTGACTCTGG - Intronic
1012264547 6:97125645-97125667 GTGATTAGGCCATCTGTGTTTGG + Intronic
1012448709 6:99332363-99332385 GTTGTTAAGCCCATTGTTTTTGG - Intronic
1015768835 6:136748169-136748191 GGGATTAAGTCCACTGACTAAGG - Intronic
1017931738 6:158961418-158961440 ATGATTAACCTCACTGCCTTAGG - Intergenic
1022402258 7:30050953-30050975 GTAATTTAGCCCACTTTCATGGG - Intronic
1023605057 7:41922710-41922732 GTGAAAAATACCACTGTCTTAGG + Intergenic
1023704225 7:42923637-42923659 CTTATTAACCCCAGTGTCTTAGG - Intronic
1024651245 7:51405174-51405196 GTCATTGTGCCCACTGTCTCTGG - Intergenic
1024857345 7:53796844-53796866 GTGCATAAGCCCTATGTCTTGGG - Intergenic
1025055378 7:55760755-55760777 GTCATTGTGCCCACTGTCTCTGG - Intergenic
1027642164 7:80749539-80749561 GTGGTTGAGAACACTGTCTTTGG + Intronic
1030435214 7:109509206-109509228 GTGGTTAAGCCCACTGGCTCTGG - Intergenic
1031090401 7:117347809-117347831 GAGATTATGCCCTTTGTCTTCGG + Intergenic
1032109262 7:129061357-129061379 GTCATTATGCCCACTGGCCTTGG + Intergenic
1034697186 7:153064251-153064273 ATGAATAAGCCCACTTTCTAAGG - Intergenic
1039280469 8:35978882-35978904 GTGATTTAGCCAAGTGTCATAGG + Intergenic
1041196481 8:55406726-55406748 GTTATAAAGGCCAATGTCTTTGG + Intronic
1043171602 8:76972885-76972907 GTGAATAAGCCCATTGCCTGAGG + Intergenic
1043529374 8:81132958-81132980 GTGGTAAAGCTCAGTGTCTTAGG - Intergenic
1044868274 8:96593689-96593711 GTGGTTAAGGGCACCGTCTTTGG + Intronic
1046727061 8:117687252-117687274 ATAATTAAGTGCACTGTCTTTGG + Intergenic
1046746337 8:117880276-117880298 GTCATTCAGCACGCTGTCTTTGG - Intronic
1048349765 8:133606801-133606823 GGGATTAAGCTCTCTGGCTTTGG - Intergenic
1048736538 8:137508347-137508369 GTGATTAAACTCATTGTTTTTGG + Intergenic
1048999693 8:139816769-139816791 GTGGATAAGGACACTGTCTTGGG + Intronic
1050910814 9:11067396-11067418 TTGATTAAGCTCACTTTTTTGGG + Intergenic
1051672306 9:19523240-19523262 GTGGTTAAGAGCACTGGCTTGGG + Intronic
1051696024 9:19768596-19768618 GTGAATAATCCCATTGTCTAGGG - Intronic
1051715757 9:19981870-19981892 GTGATCAAGCCCAATGTCATGGG + Intergenic
1053478198 9:38396937-38396959 TTCATCAAGCCTACTGTCTTTGG + Exonic
1055351135 9:75389554-75389576 GTGATTAATCCCACTTACCTTGG + Intergenic
1055492910 9:76824660-76824682 CTGATTAGGCCTACTCTCTTGGG + Intronic
1061073935 9:128329256-128329278 GATATTAAGGCCACTGGCTTTGG + Intronic
1187310655 X:18138006-18138028 GTGATAAAGTTCACAGTCTTGGG - Intergenic
1187411765 X:19056882-19056904 GTGATTAAGGAGACTGACTTGGG + Intronic
1188033437 X:25290119-25290141 GTCATAAAGAACACTGTCTTCGG + Intergenic
1191061521 X:56302642-56302664 GTGATTAATTACACGGTCTTAGG + Intergenic
1191442608 X:60826427-60826449 GTTATTAAACCCTCTTTCTTTGG + Intergenic
1192224612 X:69219746-69219768 GTGATTAAGAACACAGACTTTGG + Intergenic
1193017262 X:76749662-76749684 GTGGTTAAGCACACTGCCTGAGG + Intergenic
1194655680 X:96570466-96570488 CTGACTAAGCCCACTTTCTCAGG - Intergenic
1198722038 X:139633514-139633536 GTGATTAAGAGCACAGACTTAGG - Intronic