ID: 928609869

View in Genome Browser
Species Human (GRCh38)
Location 2:32982468-32982490
Sequence GGTGATTAAGCCCACTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928609869_928609873 16 Left 928609869 2:32982468-32982490 CCAAGACAGTGGGCTTAATCACC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 928609873 2:32982507-32982529 AAGTTAATCACCAAGACAGTGGG 0: 1
1: 39
2: 732
3: 1284
4: 1702
928609869_928609872 15 Left 928609869 2:32982468-32982490 CCAAGACAGTGGGCTTAATCACC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510
928609869_928609874 17 Left 928609869 2:32982468-32982490 CCAAGACAGTGGGCTTAATCACC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 928609874 2:32982508-32982530 AGTTAATCACCAAGACAGTGGGG 0: 1
1: 40
2: 680
3: 1193
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928609869 Original CRISPR GGTGATTAAGCCCACTGTCT TGG (reversed) Intronic
903605777 1:24574095-24574117 GGTGCTTAAGCCTTCAGTCTGGG + Intronic
913078896 1:115363872-115363894 TGTGATTAAGCCCATGTTCTGGG + Intergenic
914757639 1:150573463-150573485 GGTGATTCAGCTCACTTTCAAGG + Intergenic
916695847 1:167235557-167235579 GGTGATTGAGCCCATTTCCTGGG + Intronic
916789695 1:168114577-168114599 GATGCTGAAGCCAACTGTCTGGG + Intronic
921806811 1:219464463-219464485 GGTGATTTAGATCACTGCCTGGG - Intergenic
1066316521 10:34252610-34252632 GGTGATAAACTCCACTGTGTCGG - Intronic
1069649686 10:70036534-70036556 TGTTATTAAGCCCACTTTATAGG - Intergenic
1071252659 10:83836877-83836899 ATTGATTAAGCTCACTCTCTGGG - Intergenic
1075677070 10:124303256-124303278 GATGATCAAGCCCATTGTCCAGG + Intergenic
1076318037 10:129556637-129556659 GGTGTTTATGAACACTGTCTGGG - Intronic
1082248736 11:49956236-49956258 GAAGATTATGCCCACTGTCAAGG + Intergenic
1083972626 11:66090071-66090093 GGTAATTATGCCCACAGTCCCGG - Intronic
1084098100 11:66926105-66926127 TGTGATAAAGGCCACTGTCCAGG + Intronic
1091364932 11:135010342-135010364 GGTAATTAAGCCTAGAGTCTTGG + Intergenic
1096635991 12:52959993-52960015 GGAGATTATGCTCATTGTCTGGG - Intergenic
1098745944 12:74236713-74236735 GGTGATTAATCCTACTGCCAAGG + Intergenic
1107506107 13:41035447-41035469 GGTCATTTAGACCACTGTATAGG + Intronic
1108308862 13:49165980-49166002 AGTGTTTGAGCACACTGTCTGGG - Intronic
1110490626 13:76101167-76101189 GGGCATTATGCTCACTGTCTGGG + Intergenic
1119934285 14:78576694-78576716 TGTGATTAAGCCCAGTGTCAAGG + Intronic
1120095408 14:80382349-80382371 GAAGATTAAACCCACTATCTTGG + Intronic
1120312265 14:82844398-82844420 GGTGATGAAGCACAGGGTCTTGG + Intergenic
1121116357 14:91345807-91345829 GGTGACCAAGCCCATCGTCTAGG - Intronic
1121789282 14:96686880-96686902 GATGATGGAGGCCACTGTCTTGG - Intergenic
1123942740 15:25224460-25224482 GGTGGGAAGGCCCACTGTCTAGG + Intergenic
1127853464 15:62935442-62935464 GGTGATTAAGTGCACAGTGTAGG + Intergenic
1128753028 15:70162472-70162494 GGTGCTTAAGAGCACTGGCTTGG + Intergenic
1130826730 15:87556420-87556442 GTTTAGTAAGCCCAATGTCTGGG + Intergenic
1135671974 16:24383091-24383113 GGTGAGTAGCCCCATTGTCTTGG - Intergenic
1137571695 16:49570577-49570599 GGTAATTAAGCATACTGTTTTGG - Intronic
1138279586 16:55762590-55762612 GGTGTGTATGCTCACTGTCTAGG + Intergenic
1139426957 16:66887111-66887133 GGTGGTTTATCCCACAGTCTTGG - Exonic
1141914710 16:87087392-87087414 GGTGATTGAGCTCAGTCTCTTGG - Intronic
1142399389 16:89851401-89851423 GGTGAGAAAGCCCACTTGCTGGG + Intronic
1146001511 17:29133333-29133355 GGTGATTCAGGCCACAGACTTGG - Intronic
1150829889 17:68510218-68510240 AGTGATTAAGATCACTGCCTGGG + Intergenic
1153104485 18:1511207-1511229 GGTGCCTGAGCTCACTGTCTGGG - Intergenic
1154352957 18:13602204-13602226 GGGTATTATGCTCACTGTCTTGG + Intronic
1164791658 19:30990507-30990529 GTTCACTAAGCCCACTGCCTGGG - Intergenic
1165823523 19:38692605-38692627 GGTGATGAAGCCCATGGGCTGGG + Intronic
1168365296 19:55781731-55781753 GGAGAGGAAGCCCAATGTCTTGG + Intergenic
925479302 2:4251910-4251932 GGTGGTTAAGCTCACAGTCAGGG + Intergenic
926810512 2:16751657-16751679 GGAGATTAGTCCCACTGTCAAGG - Intergenic
928100661 2:28435685-28435707 AGGGACTCAGCCCACTGTCTGGG + Intergenic
928609869 2:32982468-32982490 GGTGATTAAGCCCACTGTCTTGG - Intronic
933628478 2:84629718-84629740 GGTACTTAAGACCACAGTCTGGG - Intronic
941869748 2:170371800-170371822 GGTGATTAAAACCACTGGCTTGG + Intronic
948863194 2:240762875-240762897 TGTGGTGAGGCCCACTGTCTAGG - Intronic
1169430118 20:5528907-5528929 GGTGAAATAACCCACTGTCTGGG + Intergenic
1172263503 20:33590360-33590382 GCTAATTAAGCCCTCTGTTTGGG - Intronic
1172429861 20:34880682-34880704 AATTATTAAGCCCAATGTCTGGG - Intronic
1173674434 20:44821547-44821569 GGAGATTGAGCCCACTCCCTTGG - Intergenic
1175989382 20:62780114-62780136 GCTGAATAAGCCCCCTGCCTGGG + Intergenic
1178105800 21:29317886-29317908 GTTGCTTAACCTCACTGTCTCGG - Intronic
1182751643 22:32646269-32646291 GGTGTTTCCTCCCACTGTCTTGG + Intronic
1183523543 22:38310447-38310469 GGGGATGAAGCCCACCGTCCCGG + Intronic
950667869 3:14508180-14508202 GGTGATTATGCCCATTCTCCAGG - Intronic
956931610 3:74049982-74050004 GGTGATTAAGGCCACTGGAGTGG + Intergenic
960416353 3:117389810-117389832 TGTGATCAACCCCTCTGTCTGGG + Intergenic
967228984 3:187319774-187319796 GGTGATGCATCCCACTGTTTAGG + Intergenic
967346739 3:188465429-188465451 GAGGATTAAGCCCAGTGTTTGGG - Intronic
969808430 4:9628682-9628704 GGTGAGTAAGAACACAGTCTTGG - Intergenic
969866443 4:10079639-10079661 AGAGATGAAGGCCACTGTCTGGG - Intronic
970438754 4:16061497-16061519 GGAGCTAAAGCCCACTTTCTCGG + Intronic
971803228 4:31319421-31319443 GGTCAATATGCCCACTATCTGGG + Intergenic
977665481 4:99642850-99642872 GGTGATTTTCCCCTCTGTCTGGG - Intronic
982556380 4:156871164-156871186 GCTGATTAAAACCCCTGTCTTGG - Intronic
986802945 5:11280396-11280418 GGTGGTTAAGTCCACAGTCAAGG + Intronic
988989780 5:36659134-36659156 GATCATTATGCCTACTGTCTTGG - Intronic
993089205 5:83402979-83403001 AGTGCATAAGCCCACTGACTTGG - Intergenic
996307377 5:122064022-122064044 GATGATTCAGACCACAGTCTGGG - Exonic
1001075101 5:168620664-168620686 GGTGATTAAGCTCAATCTCCAGG + Intergenic
1003693901 6:8382791-8382813 GGAGATTATGCAAACTGTCTAGG - Intergenic
1011124658 6:83994203-83994225 GGTGATTAGGCCCTATCTCTAGG - Intergenic
1011476834 6:87756518-87756540 GCTGATTAAGAACACTGACTTGG + Intergenic
1014639156 6:123887846-123887868 GGTGATTAAGACCATGGGCTGGG + Intronic
1017837852 6:158195979-158196001 AGTGATTAAGAGCACTGACTGGG + Exonic
1018667963 6:166156628-166156650 ATTGATTAAACCCACTGTCCAGG - Intergenic
1019198173 6:170294420-170294442 GCTGAGTAACCCCAGTGTCTAGG + Intergenic
1020868269 7:13592805-13592827 GGTGAATATGCTCACTCTCTTGG - Intergenic
1022348044 7:29537668-29537690 GGTGATTAAGCCGACTCTGCAGG + Intergenic
1024857346 7:53796845-53796867 GGTGCATAAGCCCTATGTCTTGG - Intergenic
1032749912 7:134828604-134828626 TGAAATTAAGCCCAGTGTCTAGG - Intronic
1042530528 8:69810293-69810315 GCTGCTTATGCCCACTGCCTGGG - Intronic
1042579676 8:70263169-70263191 GGTTATCAGGTCCACTGTCTAGG - Intronic
1043398994 8:79865273-79865295 GGAAATGAGGCCCACTGTCTTGG - Intergenic
1047211886 8:122847299-122847321 GGGGGTTGAGCCCACTGTCCAGG + Intronic
1047351745 8:124080704-124080726 GGTGATTAAGTCTTCTGTCATGG + Intronic
1048568531 8:135629937-135629959 GGTGTTTCTGCCCATTGTCTCGG - Intronic
1051696025 9:19768597-19768619 TGTGAATAATCCCATTGTCTAGG - Intronic
1051715756 9:19981869-19981891 TGTGATCAAGCCCAATGTCATGG + Intergenic
1052242230 9:26288011-26288033 GGGTATTATGCCCACTATCTGGG - Intergenic
1053382232 9:37658377-37658399 GGTGAGTGAGCCCCCTCTCTGGG + Intronic
1056972706 9:91220883-91220905 GCTGATTAAGCCCACTGCTTTGG + Exonic
1062193312 9:135258767-135258789 GGTGGTGATGCCCACTGTATGGG + Intergenic
1188586410 X:31781268-31781290 AGTGGTTAAGCACATTGTCTTGG - Intronic
1188637584 X:32453216-32453238 GGTGAGCAAGACCACTGCCTTGG - Intronic
1190397613 X:50000607-50000629 AGTGGTTAGGCCCACTGTCTTGG + Intronic
1194549256 X:95275012-95275034 GTGGATTCAGCCTACTGTCTTGG - Intergenic
1195828458 X:109029207-109029229 GGAGATCAAGTCCACTGTGTAGG - Intergenic