ID: 928609870

View in Genome Browser
Species Human (GRCh38)
Location 2:32982489-32982511
Sequence AACTTGGTGATTAACTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928609870_928609876 10 Left 928609870 2:32982489-32982511 CCAAGACAGTTAATCACCAAGTT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 928609876 2:32982522-32982544 ACAGTGGGGAAAATGTCTCCAGG 0: 51
1: 1190
2: 1773
3: 1345
4: 897
928609870_928609873 -5 Left 928609870 2:32982489-32982511 CCAAGACAGTTAATCACCAAGTT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 928609873 2:32982507-32982529 AAGTTAATCACCAAGACAGTGGG 0: 1
1: 39
2: 732
3: 1284
4: 1702
928609870_928609872 -6 Left 928609870 2:32982489-32982511 CCAAGACAGTTAATCACCAAGTT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510
928609870_928609874 -4 Left 928609870 2:32982489-32982511 CCAAGACAGTTAATCACCAAGTT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 928609874 2:32982508-32982530 AGTTAATCACCAAGACAGTGGGG 0: 1
1: 40
2: 680
3: 1193
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928609870 Original CRISPR AACTTGGTGATTAACTGTCT TGG (reversed) Intronic
900734649 1:4290529-4290551 AATCTGGTGATTATGTGTCTTGG + Intergenic
903936551 1:26899164-26899186 CACTTGGTGATAAACAGTATAGG + Intronic
909041356 1:70656154-70656176 TTCTTGGTGATTAGATGTCTAGG + Intergenic
909069283 1:70974996-70975018 AACTTGGAGAATCACTTTCTTGG + Intronic
910779991 1:90920790-90920812 AACTTTGTGAATAAGTTTCTAGG - Intronic
911507115 1:98766998-98767020 AACTTGGGGACAATCTGTCTGGG - Intergenic
913309487 1:117474064-117474086 CAGTTGATGTTTAACTGTCTGGG + Intronic
915958361 1:160242600-160242622 ATCTTGGTGATTTACTGTTGGGG - Intronic
916633235 1:166639000-166639022 AACCTGATGATTATGTGTCTTGG - Intergenic
916904196 1:169263782-169263804 AATTTGATGATTATGTGTCTTGG - Intronic
917096765 1:171406075-171406097 GACTTGATGATTAAGTGCCTAGG - Intergenic
917664926 1:177216953-177216975 AATTTGATTATTAAATGTCTTGG + Intronic
917832877 1:178912637-178912659 AATGTGATGATTAAGTGTCTTGG + Intronic
920198390 1:204244497-204244519 CACTTGCTGATTGACTGACTAGG + Intronic
921363176 1:214349261-214349283 GAGATGGTGATTAAATGTCTGGG + Exonic
924779508 1:247133473-247133495 AATTTGCTGATTATGTGTCTTGG - Intronic
924883853 1:248190638-248190660 AACCTGATGATTATGTGTCTTGG - Intergenic
1066132793 10:32410347-32410369 TACTTGTTGACTATCTGTCTTGG + Intergenic
1068313873 10:55316247-55316269 AACTCAGTGATTACCTGTCAGGG + Intronic
1068459486 10:57308677-57308699 AACTGGGTGTTAAACTGTTTTGG - Intergenic
1070632670 10:78098054-78098076 AATTTGATGATTATGTGTCTTGG - Intergenic
1072888537 10:99301187-99301209 ACCTTGGGGAAGAACTGTCTAGG - Intergenic
1074056405 10:109926118-109926140 AACTTCGCGATTAAGTGTCAGGG - Intergenic
1074615111 10:115059798-115059820 AACTTTGTGATTAGCTGTCATGG + Intergenic
1079602237 11:22323890-22323912 AACTTTGTGTATAACTGTCATGG + Intergenic
1079654583 11:22972697-22972719 AATTTGATGATTATGTGTCTCGG + Intergenic
1080214873 11:29828742-29828764 AATTTGATGATTATGTGTCTTGG - Intergenic
1081454783 11:43211153-43211175 AATTTGATGATTATATGTCTTGG + Intergenic
1086755794 11:90559891-90559913 AGCTTGGTAACTAACTCTCTTGG - Intergenic
1087309879 11:96529020-96529042 AATTTGATGATTATGTGTCTTGG - Intergenic
1088020559 11:105113143-105113165 AATCTGCTGATTATCTGTCTTGG - Intergenic
1088806361 11:113356885-113356907 AATTTGATGATTATGTGTCTTGG + Intronic
1089728414 11:120503544-120503566 TACTTGGTTATTAACTGTATAGG + Intergenic
1090631819 11:128656240-128656262 AACTTGGTGATTGCCAGTCTTGG + Intergenic
1090734599 11:129600006-129600028 AATTTGATGATTATGTGTCTCGG - Intergenic
1094796697 12:33981806-33981828 ATCATGGTCATTAATTGTCTAGG - Intergenic
1095109255 12:38273789-38273811 ATCATGGTCATTAATTGTCTAGG - Intergenic
1095595479 12:43952826-43952848 AATCTGGTGATTACGTGTCTTGG - Intronic
1098077880 12:66752749-66752771 ACCTTTGTGCTTCACTGTCTAGG + Intronic
1098145320 12:67491343-67491365 AATTGGATGATTAAGTGTCTTGG - Intergenic
1099676942 12:85773224-85773246 CTCTTGGTGTTTTACTGTCTTGG + Intergenic
1099717182 12:86310735-86310757 AACATGGTGAATCCCTGTCTCGG + Intronic
1100768560 12:97896750-97896772 AACCTGATGATTATGTGTCTTGG + Intergenic
1101864889 12:108513559-108513581 ATCTTGTTGATCATCTGTCTAGG - Intergenic
1103254088 12:119525334-119525356 AACCTGATGATTATGTGTCTTGG - Intronic
1104886192 12:132110137-132110159 AACTCTGTGTTTAACTGTTTAGG + Intronic
1105873027 13:24525822-24525844 AACCTTGTGTTTAACTGTCAGGG + Intergenic
1106676136 13:31960491-31960513 AATTTGGTTATTATCTGTGTGGG - Intergenic
1109332932 13:60953537-60953559 TAATTGGTAATTACCTGTCTTGG + Intergenic
1110402514 13:75110171-75110193 AATCTGGTGATTATGTGTCTTGG - Intergenic
1111196397 13:84879637-84879659 AAGATGGTCATTAAATGTCTGGG - Intergenic
1111278067 13:85978463-85978485 AACTTTGTGATTTATTGACTTGG + Intergenic
1115379644 14:32721753-32721775 AACTTGGTGATTTTCAGTCTTGG + Intronic
1116560749 14:46376051-46376073 AACTCGATGATTATGTGTCTTGG + Intergenic
1117240860 14:53830873-53830895 AACCTGGTGACTAAGTGCCTAGG - Intergenic
1117829420 14:59734919-59734941 AATTTGATGATTATGTGTCTTGG - Intronic
1118510843 14:66471455-66471477 AACTTGGTGCTTACCTGTCTAGG + Intergenic
1123706884 15:22956995-22957017 ACCTTGGTGTTGAGCTGTCTTGG - Intronic
1124218441 15:27828702-27828724 AACATGGTGATTACTTATCTGGG + Intronic
1124474429 15:30020379-30020401 AACCTGATGATTATGTGTCTTGG - Intergenic
1126956413 15:53937566-53937588 AACCTGATGATTATGTGTCTTGG - Intergenic
1133873618 16:9712552-9712574 AGCTTGGTGCCTGACTGTCTTGG + Intergenic
1136855251 16:33650444-33650466 AACCTGATGATTATGTGTCTCGG - Intergenic
1137569837 16:49558128-49558150 AACCTGGTGGTTAACTCTCCAGG + Intronic
1140419947 16:74811128-74811150 AACTTGGAACTTATCTGTCTAGG + Intergenic
1141448382 16:84079093-84079115 ATCTGGGTGTTTAACAGTCTGGG + Intronic
1203116836 16_KI270728v1_random:1498925-1498947 AACCTGATGATTATGTGTCTCGG - Intergenic
1142911753 17:3099210-3099232 AACCTGATGATTATGTGTCTTGG - Intergenic
1143790050 17:9287537-9287559 AACTTGGCTGTTAATTGTCTGGG - Intronic
1147817365 17:43219852-43219874 AACTTGGTAACTAGCTGGCTGGG + Exonic
1147884197 17:43673762-43673784 AACTGGGAAATTAACTGTTTAGG - Intergenic
1155769116 18:29674216-29674238 AATCTGATGATTATCTGTCTTGG - Intergenic
1155774043 18:29736802-29736824 AATCTGGTGATTATGTGTCTTGG + Intergenic
1156104106 18:33636150-33636172 AGCTTGGTGATTTACTGAGTTGG + Intronic
1156414968 18:36878472-36878494 AATCTGGTGATTATGTGTCTTGG + Intronic
1157993969 18:52532763-52532785 AACCTGGAGATGAACTGTCATGG + Intronic
1158290428 18:55934560-55934582 AAATTGATGATTAATTGTCAAGG + Intergenic
1159239569 18:65724370-65724392 AACTTGCTGGTTAACTGTCAAGG - Intergenic
1159269303 18:66128326-66128348 AACTTGGTGGTCTACAGTCTAGG - Intergenic
1159543067 18:69804174-69804196 AACTTGGTGAATAAATATTTAGG + Intronic
1164948645 19:32317692-32317714 AACCTGGTGAGTAACTGTTCTGG + Intergenic
1165650591 19:37485205-37485227 GACTTGGTGATTGACTGGGTTGG - Exonic
925467388 2:4119479-4119501 AACCTGACGATTAAGTGTCTTGG + Intergenic
926665896 2:15522669-15522691 AACTTGGTTATTAATTCTCATGG - Intronic
926970467 2:18462673-18462695 AATCTGATGATTATCTGTCTTGG + Intergenic
927919467 2:26960926-26960948 ACTTTGGGGATTAACTGTCTTGG + Intergenic
928609870 2:32982489-32982511 AACTTGGTGATTAACTGTCTTGG - Intronic
928804874 2:35139055-35139077 AATCTGATGATTAAGTGTCTTGG + Intergenic
929416788 2:41751078-41751100 AACTTGGTGATTATTTGTTTAGG - Intergenic
930523963 2:52502620-52502642 GACTTGGTAATTCACTGTCTTGG - Intergenic
930724467 2:54668734-54668756 AACTTGGAGATAAAGTGTTTAGG - Exonic
931423604 2:62150860-62150882 ATCCTGGTGAGTAACTCTCTAGG + Intergenic
933324408 2:80816831-80816853 AATCTGGTGATTATGTGTCTTGG - Intergenic
933390969 2:81666285-81666307 AACTTGGTGACTAATGGTCTTGG + Intergenic
935291839 2:101617724-101617746 AACCAGGTGATTGAGTGTCTGGG - Intergenic
935340492 2:102055451-102055473 ATCTTGGGCATTGACTGTCTTGG + Intergenic
936689591 2:114870892-114870914 AACTTGTTGATTAAATGACTGGG + Intronic
936699976 2:114999722-114999744 AACTTGGAGTTTAAGTGTCAAGG - Intronic
936893736 2:117403071-117403093 AAAAATGTGATTAACTGTCTAGG + Intergenic
937609449 2:123842307-123842329 AATTTGGTGATTATATGCCTTGG - Intergenic
939022795 2:136979250-136979272 AATCTGATGATTATCTGTCTTGG + Intronic
939242764 2:139582780-139582802 AAATTGGTGGTTTCCTGTCTGGG + Intergenic
939398531 2:141661863-141661885 AAATTGATGATTATGTGTCTTGG - Intronic
939475461 2:142680925-142680947 AACTTTGTCATTAACAGTGTTGG - Intergenic
939640666 2:144637129-144637151 AATTTGATGATTATGTGTCTTGG + Intergenic
940054378 2:149498685-149498707 AATCTGGTGATTATGTGTCTTGG + Intergenic
940096251 2:149979195-149979217 AATCTGGTGATTATGTGTCTTGG - Intergenic
940400874 2:153246331-153246353 AACCTGGTGACTATGTGTCTTGG - Intergenic
940593824 2:155765571-155765593 AATTTGATGATTATGTGTCTTGG + Intergenic
941239218 2:163016074-163016096 AACCTGATGATTATGTGTCTTGG + Intergenic
942057019 2:172193565-172193587 AATTTGGTGATAATGTGTCTAGG + Intergenic
946852201 2:223918727-223918749 CACTTGGTGGTTGACCGTCTGGG + Intronic
1171072655 20:22090475-22090497 AACCAGTTGGTTAACTGTCTTGG + Intergenic
1172826314 20:37789967-37789989 ATCTTGGTTATTAACTGTAAAGG + Intronic
1173751314 20:45478927-45478949 AACTGGGTGATTAGCTGTAGAGG - Intronic
1174956540 20:55104543-55104565 AACATGGTAATTAATTCTCTGGG - Intergenic
1175453901 20:59095215-59095237 AACTTGGTGATTGATTGGCCAGG - Intergenic
1176916224 21:14628715-14628737 AACTTGCTTTTTAACTGACTGGG - Intronic
1179233488 21:39525882-39525904 GGCTTGGTCATTAACAGTCTGGG - Intergenic
1183761165 22:39819454-39819476 TACTTGGTAATTAACACTCTGGG - Intronic
1183788015 22:40042807-40042829 AAGTTGGTGCTTGACTTTCTGGG - Exonic
950506143 3:13395815-13395837 AACTCTGTGTTTAACTGTTTGGG + Intronic
953053098 3:39363545-39363567 AATTTGATGATTATGTGTCTTGG - Intergenic
953785071 3:45905354-45905376 AAATGGGTCATTAGCTGTCTGGG - Intronic
957587571 3:82152132-82152154 AACTTGTTGATAAACTACCTAGG + Intergenic
959328495 3:104970797-104970819 ACCTTGTTGATTTTCTGTCTGGG + Intergenic
960302351 3:116019073-116019095 AGTTTGGTGATTCAGTGTCTTGG - Intronic
962267279 3:133952891-133952913 AACATGGTGTTTGACTGTGTGGG - Intronic
963081471 3:141399023-141399045 AATTTGGTGATTACCTCCCTTGG + Intronic
963976487 3:151485483-151485505 AATCTGGTGATTATGTGTCTTGG - Intergenic
965095645 3:164221506-164221528 AGCTTAGTGATTAAATGGCTTGG - Intergenic
965657731 3:171006774-171006796 AACTTCGTGTTTGACTGCCTGGG - Intronic
967987920 3:195109088-195109110 GACTGGGTGATTAACAGTCCTGG - Intronic
968404542 4:328570-328592 AATCTGATGATTACCTGTCTTGG - Intergenic
968692297 4:1998829-1998851 AATTTGATGATTATGTGTCTTGG - Intronic
969616665 4:8256933-8256955 AACCCTGTGATGAACTGTCTTGG - Intergenic
970727345 4:19061834-19061856 AATCTGGTGATTATGTGTCTTGG - Intergenic
974130350 4:57747180-57747202 AACCTGATGATTATGTGTCTTGG + Intergenic
974306928 4:60154862-60154884 AATTTGATGATTATGTGTCTTGG + Intergenic
975704128 4:77094942-77094964 AACTTGGTGAATAACTACCTGGG - Intergenic
977042480 4:92031292-92031314 AACTTGGGACTTACCTGTCTAGG - Intergenic
979024014 4:115544621-115544643 AACTTGGGACTTACCTGTCTAGG - Intergenic
979179667 4:117709063-117709085 AATTTGATGATTATGTGTCTTGG - Intergenic
979306418 4:119149597-119149619 AACATGGTGATTAATACTCTGGG - Intronic
979775607 4:124584753-124584775 AACCTGATGATTATGTGTCTTGG - Intergenic
980060404 4:128122703-128122725 AACTGGATGATTATCTCTCTTGG + Intronic
980564851 4:134526348-134526370 ATTTTGGTTATTAACTGTTTTGG + Intergenic
980645124 4:135634266-135634288 AATTTGATGATTATGTGTCTTGG + Intergenic
980855396 4:138433052-138433074 AATCTGATGATTATCTGTCTTGG - Intergenic
981237708 4:142437441-142437463 AATATGGTGATTATGTGTCTTGG - Intronic
981693460 4:147535094-147535116 AAGTTGGTGATTAATTTTGTGGG + Intronic
982320476 4:154071986-154072008 AAACTGGTGATTACCTGTCTTGG + Intergenic
983957899 4:173718180-173718202 AATTTGATGATTATGTGTCTTGG - Intergenic
984625932 4:182008182-182008204 AATTTGATGATTATGTGTCTTGG + Intergenic
986617727 5:9637386-9637408 AACTTGGTGACTATGTGCCTAGG + Intronic
986879759 5:12155181-12155203 AATTTGATGATTATGTGTCTTGG - Intergenic
987054646 5:14179794-14179816 AAATTAATGATTAACTGTCTGGG + Intronic
987949657 5:24659182-24659204 AATTTGATGATTATATGTCTTGG + Intergenic
987957094 5:24754247-24754269 AATTTGATGATTATGTGTCTTGG + Intergenic
988376773 5:30446207-30446229 AACTTAGTCAATAACTGTCTTGG - Intergenic
988627848 5:32897334-32897356 AATCTGGTGATTATGTGTCTCGG + Intergenic
988637600 5:33003690-33003712 AATTTGGTTATTATTTGTCTTGG + Intergenic
988681905 5:33491726-33491748 AATTTGGTGATCAAGGGTCTAGG + Intergenic
988865156 5:35326038-35326060 AATCTGATGATTAAGTGTCTTGG - Intergenic
989666042 5:43855177-43855199 AACTCAGTGACTAACTGGCTTGG - Intergenic
990163537 5:52970204-52970226 AATTTGATGATTATGTGTCTTGG + Intergenic
990929232 5:61068872-61068894 ATCTTAGTGGTTAAGTGTCTAGG + Intronic
990979648 5:61591277-61591299 ACCATGGTGATTTACTGTCATGG - Intergenic
991181707 5:63759240-63759262 AACTTGGTAATTAAAAGTCATGG - Intergenic
991593383 5:68277735-68277757 AACTCGGTGATTGACTGCATTGG - Intronic
993178346 5:84517459-84517481 AATTTGATGATTATCTCTCTTGG + Intergenic
993505844 5:88707784-88707806 AACTTGATGATTAACAAGCTAGG - Intergenic
993986375 5:94602390-94602412 AACCTGATGATTATGTGTCTTGG - Intronic
993986999 5:94609588-94609610 TACTTGGTAATTATCTTTCTAGG - Intronic
994227704 5:97272872-97272894 AATCTGGTGATTATGTGTCTTGG + Intergenic
994298968 5:98123069-98123091 AATCTGGTGATTATGTGTCTTGG - Intergenic
995083357 5:108079876-108079898 CACTGTGTGATTAACTGACTTGG + Intronic
995108376 5:108400452-108400474 AATCTGGTGATTATGTGTCTTGG - Intergenic
996598661 5:125235058-125235080 ACCTTGGTAAATAAATGTCTTGG - Intergenic
999543915 5:152605800-152605822 AAGTTGTTGCTTTACTGTCTTGG + Intergenic
1000955125 5:167534138-167534160 CACTTGGTAAGTAACTGTTTTGG - Intronic
1004306127 6:14503296-14503318 TACTTGCTGATTAACTGAATTGG + Intergenic
1005322628 6:24669652-24669674 AACTTGGGACTTACCTGTCTAGG - Intronic
1007326019 6:41060226-41060248 AACTTGGTGATGAATTGTGTGGG - Intronic
1008176039 6:48269457-48269479 AATTTGATGATTATGTGTCTTGG + Intergenic
1009807468 6:68620726-68620748 AACTTGGTCATTACCTCTCTGGG + Intergenic
1010265243 6:73858404-73858426 AACTTGGTGATTAAGAATGTGGG - Intergenic
1010782995 6:79966817-79966839 AATTTGATGATTATGTGTCTTGG - Intergenic
1011318539 6:86064252-86064274 AATCTGGTGATTATGTGTCTTGG + Intergenic
1012869632 6:104658076-104658098 AATGTGGTGATTATGTGTCTTGG - Intergenic
1013682775 6:112543038-112543060 AACCTGATGATTATGTGTCTTGG - Intergenic
1014155812 6:118108229-118108251 AACTTGATGTTTAACTGTACAGG + Intronic
1015320949 6:131873667-131873689 AACTTGTTCATTAACTGTTTTGG + Intronic
1015388256 6:132651027-132651049 AACTTGGTTAAGAACTGTTTTGG - Intergenic
1015578930 6:134702435-134702457 AACTTGGTGCTGCACTGTCACGG - Intergenic
1016847792 6:148586359-148586381 AAACTGGTGATTATGTGTCTTGG + Intergenic
1018755426 6:166844453-166844475 AACTTGATGACTATGTGTCTAGG - Intronic
1020588132 7:10098055-10098077 AACTTAGTGATGAAGTATCTAGG + Intergenic
1020640072 7:10743601-10743623 AATTTGATGATTATGTGTCTTGG - Intergenic
1021187156 7:17577365-17577387 AACCTGATGATTATGTGTCTTGG - Intergenic
1022867148 7:34433007-34433029 AACTTGACGATTATGTGTCTTGG - Intergenic
1023785512 7:43704268-43704290 AACCTGGTGACTATGTGTCTTGG + Intronic
1027689952 7:81332305-81332327 AATATGATGACTAACTGTCTTGG + Intergenic
1027956321 7:84883110-84883132 GTCTTGGTGATTATCAGTCTGGG - Intergenic
1028523174 7:91754126-91754148 AATTTGATGATTATATGTCTTGG - Intronic
1028640000 7:93031219-93031241 AACCTGATGATTATGTGTCTTGG - Intergenic
1028648919 7:93128775-93128797 AACTTGGGACCTAACTGTCTAGG + Intergenic
1030258115 7:107533848-107533870 AATCTGATGATTATCTGTCTTGG - Intronic
1030632542 7:111911685-111911707 CACTGGCTGATTAATTGTCTGGG - Intronic
1030687812 7:112504712-112504734 AACTTGGTGACTTAAAGTCTGGG + Intergenic
1031667275 7:124500058-124500080 AACTTGTTGATTTATTGTATTGG - Intergenic
1032101945 7:128987471-128987493 AACTTTATGATAAACTTTCTTGG - Intronic
1032501799 7:132405234-132405256 GCCTTGGTGATTAAAAGTCTGGG + Intronic
1033192465 7:139294505-139294527 TTCTTAGTGATTAAATGTCTTGG + Intronic
1039014706 8:33133689-33133711 AATTTGGAGATTGACTATCTGGG - Intergenic
1040402151 8:47062130-47062152 AATATGGTAATTAACTGTCTTGG + Intergenic
1040404251 8:47084902-47084924 AATCTGATGATTAAGTGTCTTGG + Intergenic
1041195107 8:55393927-55393949 CACTTGGTGATGAACTGTCTTGG - Intronic
1041287587 8:56276317-56276339 AACCTGATGATTATGTGTCTTGG - Intergenic
1041418913 8:57645446-57645468 AATTTGATGATTATGTGTCTTGG + Intergenic
1042032092 8:64487654-64487676 AACTTGTTGATTAACTGGTAGGG - Intergenic
1042880558 8:73483809-73483831 GACTTGGAGATTAACTGTGTGGG + Intronic
1042981944 8:74539775-74539797 AATCTGGTGATTATGTGTCTTGG + Intergenic
1043025120 8:75057375-75057397 AATTTGATGATTATGTGTCTTGG - Intergenic
1043308160 8:78823225-78823247 GTCTTGGTGATTAACATTCTTGG - Intergenic
1043672154 8:82900258-82900280 AATTTGGTGATGAACTGTAAGGG + Intergenic
1044018199 8:87072766-87072788 AACCTGATGATTATGTGTCTTGG + Intronic
1044032032 8:87250307-87250329 ACATTTGTGATTACCTGTCTTGG - Intronic
1045291725 8:100839119-100839141 CACTTGGAGAATCACTGTCTTGG + Intergenic
1045610990 8:103841421-103841443 GACTTGATGATTCTCTGTCTCGG + Intronic
1045921996 8:107541237-107541259 AACTTGGGGATTAATTTTCGTGG - Intergenic
1046768145 8:118092450-118092472 TATTTGGTTTTTAACTGTCTAGG - Intronic
1048467222 8:134675637-134675659 AATTTGATGATTATGTGTCTTGG - Intronic
1048876398 8:138839694-138839716 GACTTGGTGATTATCTGGATGGG + Intronic
1048956702 8:139543440-139543462 AACTTGGAGATGAGCTGTCTTGG - Intergenic
1052115575 9:24645283-24645305 AATTTGATGATTATGTGTCTTGG + Intergenic
1052654673 9:31341384-31341406 AACTTGATGATTAGTTCTCTCGG - Intergenic
1054164072 9:61703118-61703140 AATCTGGTAATTAACTGACTTGG - Intergenic
1060320936 9:122560786-122560808 AATTTGATGATTATGTGTCTTGG + Intergenic
1186796101 X:13047940-13047962 AAGTTTCTGATTAACTGTGTTGG + Intergenic
1186916480 X:14227964-14227986 AACTGGGTTTTTAATTGTCTTGG - Intergenic
1188300219 X:28498530-28498552 AACTTGCTAATAAACTGTATTGG - Intergenic
1188715151 X:33450943-33450965 AATCTGATGATTATCTGTCTCGG - Intergenic
1189581494 X:42412167-42412189 AATCTGATGATTATCTGTCTTGG + Intergenic
1191654259 X:63578634-63578656 AATTTGATGATTATGTGTCTTGG - Intergenic
1191665959 X:63702942-63702964 ACCTTGGTCACTAACTGACTGGG - Intronic
1191933685 X:66403415-66403437 AACCTGATGATTATGTGTCTTGG + Intergenic
1192691546 X:73370633-73370655 AACCTGCTGATTATGTGTCTTGG + Intergenic
1193176632 X:78401957-78401979 AATTTGATGATTATGTGTCTTGG - Intergenic
1193216710 X:78873224-78873246 AACTTGGTCACTAACTTTATCGG + Intergenic
1193315403 X:80059091-80059113 GATCTGGTAATTAACTGTCTTGG - Intergenic
1193819319 X:86142980-86143002 AACTTAGTGATTAATTGAATGGG + Intergenic
1194132983 X:90105213-90105235 AACCTGATGATTATCTGTCTTGG + Intergenic
1194549304 X:95275777-95275799 AAGCTGATGATTAAGTGTCTTGG - Intergenic
1194828500 X:98592875-98592897 TATCTGGTAATTAACTGTCTTGG - Intergenic
1195207985 X:102623356-102623378 AATCTGATGATTATCTGTCTTGG + Intergenic
1196513653 X:116545005-116545027 AACCTGATGATTATATGTCTTGG + Intergenic
1196583391 X:117401442-117401464 AATCTGGTGATTAAGTGTCTTGG - Intergenic
1197029938 X:121801594-121801616 AATCTGGTGATTATTTGTCTTGG + Intergenic
1197406193 X:126054248-126054270 AACTTGGTTATTATCTTGCTAGG + Intergenic
1198705565 X:139444759-139444781 AATCTGATGATTAAATGTCTTGG - Intergenic
1199120652 X:144049380-144049402 AATCTGGTGATTATGTGTCTTGG - Intergenic
1200321439 X:155194452-155194474 AACCTGATGATTATGTGTCTTGG + Intergenic
1200462253 Y:3471897-3471919 AATCTGGTAATTAACTGGCTTGG + Intergenic
1200478771 Y:3675289-3675311 AACCTGATGATTATCTGTCTTGG + Intergenic