ID: 928609872

View in Genome Browser
Species Human (GRCh38)
Location 2:32982506-32982528
Sequence CAAGTTAATCACCAAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2404
Summary {0: 1, 1: 0, 2: 53, 3: 840, 4: 1510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928609870_928609872 -6 Left 928609870 2:32982489-32982511 CCAAGACAGTTAATCACCAAGTT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510
928609869_928609872 15 Left 928609869 2:32982468-32982490 CCAAGACAGTGGGCTTAATCACC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510
928609868_928609872 16 Left 928609868 2:32982467-32982489 CCCAAGACAGTGGGCTTAATCAC 0: 1
1: 0
2: 0
3: 5
4: 141
Right 928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG 0: 1
1: 0
2: 53
3: 840
4: 1510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928609872 Original CRISPR CAAGTTAATCACCAAGACAG TGG Intronic
Too many off-targets to display for this crispr