ID: 928612560

View in Genome Browser
Species Human (GRCh38)
Location 2:33004894-33004916
Sequence CCAGGAAATCATTGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928612557_928612560 -10 Left 928612557 2:33004881-33004903 CCTGGTAACTTGGCCAGGAAATC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 928612560 2:33004894-33004916 CCAGGAAATCATTGGAAAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928612560 Original CRISPR CCAGGAAATCATTGGAAAGC TGG Intronic
906578267 1:46910683-46910705 CCAGGAAATAATTCAAATGCAGG + Intergenic
907322572 1:53614546-53614568 GCAGGAAGCCACTGGAAAGCAGG + Intronic
908552590 1:65224261-65224283 CCAGAATAGAATTGGAAAGCTGG + Intronic
908964140 1:69737624-69737646 CAAGGAAATTCTGGGAAAGCAGG - Intronic
909087800 1:71187993-71188015 CAAGGAAATGGTTGAAAAGCCGG - Intergenic
909226245 1:73026938-73026960 CTAGGAAATAATTGGGAAGAGGG - Intergenic
911756019 1:101557582-101557604 CCAAGAAATCAGTGAAATGCTGG - Intergenic
917504906 1:175618766-175618788 CCAGGAACACACTGGAAAGAGGG + Intronic
917785905 1:178457414-178457436 CTAGGAAATTATTGGAATCCTGG + Intronic
919922870 1:202176860-202176882 CCAGGATTCCACTGGAAAGCAGG - Intergenic
921106498 1:211986052-211986074 CCAATAAAGCATTGGAAAACAGG + Intronic
921532902 1:216307334-216307356 CCAGGAAAGTAGGGGAAAGCTGG + Intronic
921750319 1:218784434-218784456 ACAGGGAATCATTGGACACCTGG - Intergenic
922155456 1:223037215-223037237 CCAGCAAATCATGGGCAAGGAGG + Intergenic
924448720 1:244158685-244158707 CAAGGAAATCATTTGAACCCAGG - Intergenic
924867803 1:248004658-248004680 CCAGGAAATGATTGAACATCAGG + Intronic
1063519294 10:6726443-6726465 CCAGGAAATCAATGGTTACCTGG - Intergenic
1063652558 10:7953032-7953054 TCAGGAAATAATAGGAAAACAGG - Intronic
1063775466 10:9258734-9258756 CCATGCAATCCTGGGAAAGCAGG - Intergenic
1063933842 10:11057004-11057026 CCTGGAATTCATTTGAGAGCAGG - Intronic
1064321371 10:14308523-14308545 TCACTAAATCATAGGAAAGCAGG - Intronic
1065244316 10:23742103-23742125 CCAGGAAGTCATCGTAGAGCTGG + Intronic
1067540917 10:47152183-47152205 GCGAGAAATCAGTGGAAAGCTGG + Intergenic
1070844445 10:79510385-79510407 ACAGGAAATGATGGAAAAGCAGG - Intergenic
1070929352 10:80249923-80249945 ACAGGAAATGATGGAAAAGCAGG + Intergenic
1072559248 10:96555080-96555102 CAAGGAAATCTTTCCAAAGCAGG + Intronic
1073075799 10:100825353-100825375 CCAGGGAAGCAATGGAAGGCTGG - Intronic
1073082619 10:100869465-100869487 CCAGGAAATCCTTGCTGAGCAGG + Intergenic
1073587967 10:104728994-104729016 TCAGGAAATCATTGCAGAGTGGG + Intronic
1075542573 10:123327862-123327884 CCAAGGAATCCTTGAAAAGCTGG + Intergenic
1077453222 11:2663227-2663249 CCAGCAGATCACTGGAAAGCAGG + Intronic
1082190168 11:49233432-49233454 CCAGTGAATTCTTGGAAAGCAGG - Intergenic
1083800783 11:65045201-65045223 CCAGGACATCTCAGGAAAGCAGG + Exonic
1085551574 11:77378215-77378237 CCTGCAAAACAATGGAAAGCTGG + Intronic
1085892216 11:80594141-80594163 CCAGGAAATGAATGGCAGGCTGG + Intergenic
1086675958 11:89607480-89607502 CCAGTGAATTCTTGGAAAGCAGG + Intergenic
1087168505 11:95027039-95027061 TCATCAAATCATTGGCAAGCGGG - Exonic
1088195219 11:107266511-107266533 CCTGGCAATCAATGGAAATCAGG + Intergenic
1089024354 11:115253357-115253379 CCAGGAACTCATTAGAAAGCAGG - Intronic
1091061040 11:132462439-132462461 ACAGGAGATCACAGGAAAGCTGG + Intronic
1093135637 12:15447019-15447041 CCAAGAAGTCACTGGAAAGTGGG - Intronic
1093944885 12:25096945-25096967 ACAGGAAATCATTAAGAAGCTGG + Exonic
1095369638 12:41451877-41451899 CCAGAAAATCATTTTAAACCTGG + Intronic
1098665806 12:73161799-73161821 CCAGTAAATCAATGGAAACTAGG + Intergenic
1100217574 12:92468216-92468238 CCAGGAGATGGTTGGAAAGATGG - Intergenic
1100473356 12:94913384-94913406 ACAGGAAGTGGTTGGAAAGCTGG + Intronic
1101994071 12:109512105-109512127 CCTGGAAGCCATTGGAAAGGGGG + Intronic
1103494307 12:121349798-121349820 GCAGGAAATCATTTGAACCCAGG - Intronic
1104157148 12:126144339-126144361 CCAAGAAAGCATTGAAAAGGAGG - Intergenic
1104439202 12:128781391-128781413 CCACGAAGTCAGTGGAAATCTGG + Intergenic
1105026534 12:132852929-132852951 CCAGGAAGTCAGAGGAGAGCTGG - Intronic
1105318532 13:19292401-19292423 GAAGGAATTCATTGGAAAGCAGG - Intergenic
1106695695 13:32170333-32170355 AAAGGACATCATTGGAAAACCGG + Intronic
1107350744 13:39512179-39512201 ACAGGAAATCAGTGTTAAGCAGG - Intronic
1108001957 13:45911911-45911933 CAAGGAAATCATGGCCAAGCAGG - Intergenic
1108074118 13:46661103-46661125 CCAGGAAAACAGTGGAAGGAGGG - Intronic
1108621401 13:52187925-52187947 CCTGGAAGTCCTTGAAAAGCGGG + Intergenic
1108665240 13:52623620-52623642 CCTGGAAGTCCTTGAAAAGCGGG - Intergenic
1109186050 13:59269777-59269799 CCAGAAAATCATTAGAGACCTGG - Intergenic
1112812832 13:103238445-103238467 GCAGGAAAGCATTTTAAAGCAGG + Intergenic
1113180633 13:107621560-107621582 TCACGCAATCATTTGAAAGCTGG - Intronic
1114252548 14:20973452-20973474 CCAGGAGATGATTAGAAAGAGGG + Intergenic
1116422678 14:44751430-44751452 CCAGGAGATCCTTTAAAAGCAGG + Intergenic
1117964529 14:61193073-61193095 CTAGGCAATCATGGGAAAGATGG + Intronic
1118887295 14:69878271-69878293 CCAGGAAATCACAGGGAAGGGGG - Intronic
1120450938 14:84666004-84666026 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
1125710050 15:41777422-41777444 CCAGGAAAACAGTGGAAAAGGGG + Intronic
1126411922 15:48380963-48380985 TCAGGAAAACATTGGTAAACAGG - Intergenic
1126683082 15:51222953-51222975 GCAGGATATTATTGGAAAACTGG + Intronic
1126720596 15:51574275-51574297 TCAAGAAATTATTGGAAAACAGG - Intronic
1127232084 15:57007635-57007657 CAAAAAAATCACTGGAAAGCTGG - Intronic
1127977271 15:64006931-64006953 CCAGGAAGTCACTGAAATGCAGG + Intronic
1129159249 15:73738066-73738088 CCTGGAAATCACTGGACATCTGG + Exonic
1129616346 15:77101295-77101317 CCAGGAGATATTTGGAAAGCTGG + Exonic
1130386703 15:83418255-83418277 CCAGGAACCTATAGGAAAGCTGG + Intergenic
1132065328 15:98726255-98726277 CAGGAAAATCATAGGAAAGCAGG - Intronic
1134807025 16:17134663-17134685 TCAGGAAATCATTGGGCAGCTGG - Exonic
1135074757 16:19383593-19383615 ACAGGAAATAATCGGAAACCAGG - Intergenic
1135454093 16:22582788-22582810 CCTAGAAATCACAGGAAAGCTGG + Intergenic
1138985142 16:62319303-62319325 GCAGGAAATCATTAGAAACTGGG + Intergenic
1140556388 16:75926181-75926203 CCAGGGAACACTTGGAAAGCTGG + Intergenic
1143169521 17:4919818-4919840 CAAGGAAAGCGTTGGAATGCTGG + Intergenic
1143766287 17:9139525-9139547 TGAGGAAATCATTGGAAAACTGG - Intronic
1144146953 17:12407877-12407899 CCAGGAGCTCATTGGAAATTAGG + Intergenic
1144149093 17:12426147-12426169 ACAAGCAGTCATTGGAAAGCAGG + Intergenic
1144842913 17:18199419-18199441 CTAGGGAATCATGGGAAAACTGG - Intronic
1146212955 17:30956322-30956344 CGAGGAAATCGCTGGAAAGCCGG + Exonic
1146761017 17:35478710-35478732 ACAGGAAATAAATGGAAAGTGGG + Intronic
1148913341 17:50954977-50954999 TCAGGAAATGACAGGAAAGCCGG - Intergenic
1149694540 17:58606497-58606519 CCAGCAAATCTTTGGATAGAGGG + Intronic
1150980053 17:70131063-70131085 TCAGGAAAACACTGAAAAGCCGG + Intronic
1151337307 17:73447530-73447552 CCAGGGGATCATTGGGAAGATGG - Intronic
1153448465 18:5199032-5199054 CCAGGAAATCACTGGCACCCTGG + Intergenic
1153998634 18:10464063-10464085 TATGCAAATCATTGGAAAGCAGG - Intronic
1155159904 18:23186935-23186957 CCAGTTAATCCTAGGAAAGCAGG - Intronic
1155583488 18:27338789-27338811 GCAGGAAAACTTTGGAAAGATGG + Intergenic
1156019451 18:32583042-32583064 TTAGGAAATAATTGGGAAGCAGG - Intergenic
1159036712 18:63284951-63284973 CCAGGAAAAAAATGGAAAGGGGG + Intronic
1159190392 18:65034467-65034489 CCAGGGGATCATTGGAAAGATGG - Intergenic
1161369947 19:3905531-3905553 CCAAGAAGTCATCGGACAGCAGG - Exonic
1163141693 19:15353689-15353711 CTGGGAAATCATTAGAAAGGAGG - Exonic
1166870712 19:45868815-45868837 CCAGGAAAACATAGGCATGCTGG - Intronic
1168517717 19:57022354-57022376 CCAGGAAATTAAAGAAAAGCTGG + Intergenic
925785475 2:7428345-7428367 CAAAGAAATCATTAGAATGCAGG - Intergenic
926014857 2:9441891-9441913 CCAGAGAATTATTTGAAAGCTGG + Exonic
927443893 2:23141070-23141092 CCAGGGAATCATGAGAAGGCTGG + Intergenic
927483373 2:23471800-23471822 CCAGGAAATCACAGGGAGGCAGG - Intronic
928612560 2:33004894-33004916 CCAGGAAATCATTGGAAAGCTGG + Intronic
929801757 2:45110529-45110551 CCAGGAAAGCTTTGGAAAGAAGG - Intergenic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930901051 2:56508152-56508174 CCAGGGCATCATTTGCAAGCAGG + Intergenic
931263775 2:60642408-60642430 CCAGGAAATAAAAGGAAAACTGG - Intergenic
931525055 2:63144373-63144395 CCAGGGAATCACTGGAACCCAGG - Intronic
931763766 2:65436959-65436981 CCAGGAAATAATTGACAGGCTGG + Intergenic
932993384 2:76816104-76816126 CCAGGTAAACACAGGAAAGCAGG - Intronic
933436581 2:82257370-82257392 CCAGGGAATCCTGGCAAAGCAGG - Intergenic
936017902 2:108973463-108973485 ACTGGAAAGCACTGGAAAGCAGG - Intronic
937156928 2:119726393-119726415 TGAGGAAATAATTGGAAAACTGG + Intergenic
938740655 2:134228649-134228671 CCCAGAAACCACTGGAAAGCAGG - Intronic
939048585 2:137279955-137279977 CCATAAAGTCATGGGAAAGCCGG + Intronic
939408471 2:141791907-141791929 CTAGGAAAGCACTGGAAATCAGG - Intronic
939740537 2:145900983-145901005 CAGAGAAATCATTGGAAAGGTGG - Intergenic
943266799 2:185741677-185741699 TCAGGAAAGCATTGGTAACCAGG + Intronic
943524182 2:188996149-188996171 CCAGGAAGTGATGGGAAACCAGG + Exonic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
943818697 2:192290498-192290520 CCACAAAAGCATTGAAAAGCCGG - Intergenic
1170423448 20:16215103-16215125 ACACGGGATCATTGGAAAGCCGG + Intergenic
1171506804 20:25643318-25643340 CCATGAAATTCTTGGAAGGCAGG - Intergenic
1172751091 20:37251847-37251869 CCAGGATATCACTGGTGAGCAGG - Intronic
1173065443 20:39706299-39706321 CCAGGCAACCATTGGGAAGAGGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173759807 20:45549653-45549675 CCAAGAAATTATTGGAGAGAAGG - Intergenic
1174563468 20:51447608-51447630 CCAGCAAAACATTGCAAAACAGG - Intronic
1175287006 20:57843813-57843835 GCAGGGAATCTTTAGAAAGCAGG + Intergenic
1177125114 21:17184586-17184608 CCAGGAACTCAAAGGACAGCAGG + Intergenic
1177355008 21:19996747-19996769 CCAGGAATTCATTGGGAACTGGG + Intergenic
1177591681 21:23178635-23178657 CCAGTAAATAATTTAAAAGCAGG - Intergenic
1177930132 21:27271145-27271167 CCAGGAAATGACAGGACAGCAGG + Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
953366239 3:42348005-42348027 CCAGGAGATGATTGCAGAGCTGG + Intergenic
954701098 3:52451298-52451320 CCAGGAACTCTGTGGAAAGAGGG + Exonic
956832907 3:73070887-73070909 CCAGGAAATCAGTGGGCAGTTGG + Intergenic
959164505 3:102759450-102759472 CCAGGATATCATTTGGAATCTGG - Intergenic
961195665 3:124999325-124999347 CCAGGCAAACACTGCAAAGCTGG + Intronic
961604759 3:128085428-128085450 CCAGGCAATTCTTGGAAAACTGG - Intronic
961662356 3:128476242-128476264 CCAGGAAACTCTCGGAAAGCAGG - Intergenic
962322517 3:134403696-134403718 CCAGGAAATTCCTGGAAAACTGG - Intergenic
963478675 3:145839794-145839816 CCAGGTGATCATCGGAAAGGAGG - Intergenic
965075858 3:163974596-163974618 CCAGAGAATTATTGGGAAGCAGG + Intergenic
965491237 3:169339000-169339022 TCTGGAAATCATTGGAAAAATGG - Intronic
965553319 3:169992842-169992864 CCAGGAAATCATGGAACAGAAGG + Exonic
965668715 3:171123769-171123791 CTGGCAAATCATTGGAAAGGAGG - Intronic
965836100 3:172854511-172854533 CCAGGAAATCTGTGGACACCTGG + Intergenic
966652896 3:182321312-182321334 TCAGGAAATCATATGAAAGAGGG - Intergenic
967373222 3:188772288-188772310 CCAGGAAAGCATTTTAAGGCTGG - Intronic
969119851 4:4900099-4900121 GAAGGAAATCTTGGGAAAGCTGG + Intergenic
969723266 4:8905023-8905045 CCAGGAAAGCCTTGGAATACAGG - Intergenic
974783962 4:66593064-66593086 CAAGCAAATTATTGGAAAGGAGG + Intergenic
975357713 4:73427495-73427517 CCAGGAAATTATTGTAAGTCAGG - Intergenic
975812373 4:78182442-78182464 CCAGGAAAATAGTGGAAACCTGG - Intronic
976052330 4:81024028-81024050 TAAGGAAATCAGGGGAAAGCAGG + Intergenic
979289003 4:118959191-118959213 TCAGGACATCAAAGGAAAGCAGG + Intronic
980553324 4:134369259-134369281 CCATGAGATCATCTGAAAGCAGG + Intergenic
982473548 4:155823282-155823304 ACAGGAAATCATGGAAAAGTAGG - Intergenic
982494464 4:156073624-156073646 CCTGGAACTCACTGAAAAGCAGG - Intergenic
984653279 4:182291426-182291448 CCAGGAGATCATAGGAAATAAGG + Intronic
986111375 5:4721695-4721717 CCAGGAAAGCCTGGGAAGGCTGG - Intergenic
987440627 5:17951794-17951816 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
988691654 5:33578345-33578367 CCAGGAACTCACTTGAAAGGCGG + Intronic
988968540 5:36443580-36443602 TCATGAAATCACTGGGAAGCAGG - Intergenic
989405514 5:41056826-41056848 CAAGGAAGTCCTTGGAAAACTGG - Intronic
990025926 5:51188653-51188675 CAAGGAAATCAGTGGAAAGAGGG - Intergenic
990401034 5:55437680-55437702 CCAGAAGAACACTGGAAAGCAGG + Intronic
991195108 5:63923280-63923302 CCACGAATTCATTGGCCAGCTGG + Intergenic
994884753 5:105545926-105545948 CCAGGATTTGAATGGAAAGCTGG - Intergenic
996477781 5:123940926-123940948 CAAGGAAATCATAAGAAAGAAGG - Intergenic
999391958 5:151199673-151199695 CCAGGAACTCAGTGGTATGCTGG - Intronic
1000659830 5:163923870-163923892 CCAGAAAATCAGTGGACAGTAGG - Intergenic
1001320882 5:170680501-170680523 CCAGGAAAGCTATGGTAAGCTGG - Intronic
1002042808 5:176527212-176527234 ACAGGAAATCATTGGTAACATGG + Exonic
1002183685 5:177444105-177444127 CCAGGTAATGATGGGAAAGCTGG + Intergenic
1003031962 6:2609140-2609162 CTAGGCAATCATTGGAAGGATGG + Intergenic
1004337042 6:14773260-14773282 ACAGGAAACAATTAGAAAGCGGG - Intergenic
1009332507 6:62441306-62441328 CCAGGAAAGCAGGGGCAAGCTGG + Intergenic
1009929332 6:70157858-70157880 TCAGGAAATAATTGGAATTCAGG + Intronic
1010597702 6:77785083-77785105 TCAGGAAATCATTGGGAATTTGG + Intronic
1010755791 6:79664749-79664771 CCAGGAAACCAATGGAAAGACGG + Intronic
1011256066 6:85422338-85422360 CCAGGAAACCAGAGGAAAGGAGG - Intergenic
1012987172 6:105887394-105887416 CCAGGAAAAAGTTGGAAACCTGG + Intergenic
1014021949 6:116601243-116601265 CCTGGAAATCACTGGAATGTGGG + Intergenic
1014825106 6:126040993-126041015 TAAGGAAATCAGTGGCAAGCTGG - Intergenic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1017454226 6:154586064-154586086 CCAGAAAATCCTGGGAAAGGGGG - Intergenic
1018676752 6:166229115-166229137 CCAGGAAAGCCTTGGAGAGTTGG + Intergenic
1020464836 7:8465574-8465596 CCAGGAAAGTATTGCAAAGCAGG + Intronic
1020464849 7:8465742-8465764 CTAGGGAATAATTAGAAAGCAGG - Intronic
1020836929 7:13165259-13165281 CCATGAAATCAGTGAAAGGCAGG + Intergenic
1021620093 7:22542727-22542749 CGAGGACATCACTGGAAAGGTGG + Intronic
1022538786 7:31116219-31116241 ACATGATATCATTTGAAAGCAGG - Intergenic
1023134384 7:37036703-37036725 CCAGGAAATGATGGGAAATCAGG + Intronic
1023157399 7:37264977-37264999 CCAGGAAAATATTGGATTGCTGG - Intronic
1026614634 7:71890430-71890452 CCAGGAACTGTTTGGAAAGGAGG - Intronic
1030383366 7:108839385-108839407 GCCTGAAATCATTGGAAAGCTGG - Intergenic
1030820023 7:114084077-114084099 CGTGGAAATCCTTGGAAAACTGG - Intergenic
1035957927 8:4103359-4103381 CCTGAAAATCATTGGAGATCTGG - Intronic
1036742941 8:11381712-11381734 CCAAGAAATCATTGATAAGCTGG - Intergenic
1039226606 8:35395573-35395595 AGAGTAAATCATTTGAAAGCTGG + Intronic
1039414150 8:37379205-37379227 ACAGGAAATCCTTTGGAAGCAGG - Intergenic
1040891006 8:52315793-52315815 CCAAGAAAACATGGGAAAGATGG - Intronic
1042567425 8:70126672-70126694 CCAGGGAATGATAGGAAACCTGG - Intronic
1044741178 8:95327973-95327995 CTGGAATATCATTGGAAAGCTGG - Intergenic
1044927874 8:97224534-97224556 CCAGGAAGTCTTTGAAAAGGAGG + Intergenic
1047636779 8:126772315-126772337 TCAGCAAATCAGTGGAAACCAGG - Intergenic
1050458138 9:5853591-5853613 CCAGGAAATCATGGAAAGCCAGG + Intergenic
1051762170 9:20479588-20479610 CCAGGAAATTAGTGGCAGGCTGG - Intronic
1052651434 9:31308110-31308132 CCAGGAAAGCTTTACAAAGCAGG + Intergenic
1053093426 9:35301727-35301749 CCAGGACATCCTTGTATAGCTGG + Intronic
1053350806 9:37412164-37412186 CCAGGAAAGGAGTGGGAAGCAGG - Intergenic
1056299976 9:85230660-85230682 ACAGGAAGCCATGGGAAAGCCGG + Intergenic
1056323402 9:85457813-85457835 GCATGGAATCATTGGAAAGCTGG - Intergenic
1059024915 9:110616026-110616048 ACAGAAACTAATTGGAAAGCTGG - Intergenic
1061090780 9:128424813-128424835 GCAGGAAATCATTTGAACCCGGG - Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1186946908 X:14578843-14578865 CCAGGCAGTCATTTGGAAGCTGG - Intronic
1187756805 X:22536924-22536946 GCTGGAAATCAATGGAAAACAGG + Intergenic
1188297666 X:28469749-28469771 CCATTAAATCATTGCAAAGGTGG - Intergenic
1190044542 X:47101477-47101499 CCTGGTAGTTATTGGAAAGCCGG - Intergenic
1192947394 X:75980808-75980830 CATAGAAATCATTAGAAAGCAGG - Intergenic
1192981961 X:76353756-76353778 TCAGGAAATTAGGGGAAAGCTGG - Intergenic
1193070504 X:77301014-77301036 CCAGGAATTCATTGGGAACTGGG - Intergenic
1197564250 X:128062006-128062028 CCAAGAAATAATTGAAAAGGAGG + Intergenic
1197777542 X:130129043-130129065 CCAGGAAGTCATGGGCTAGCAGG + Intergenic
1199098607 X:143770876-143770898 CCAAGAAGTCATTGAGAAGCAGG - Intergenic
1199847191 X:151700039-151700061 CCAGGAACTCATTGGCACGAGGG - Exonic
1199972884 X:152873596-152873618 CCAGCAACTCATTGGCAATCTGG + Intergenic
1201292169 Y:12431485-12431507 CCAGGAATTCTTTGGATAACTGG + Intergenic
1202064858 Y:20928222-20928244 ACCCGAAATGATTGGAAAGCTGG - Intergenic