ID: 928615525

View in Genome Browser
Species Human (GRCh38)
Location 2:33035089-33035111
Sequence TCCCCTTGTTGCCGATGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928615520_928615525 -5 Left 928615520 2:33035071-33035093 CCGTAGCCGACCCTTGGTTCCCC 0: 1
1: 0
2: 2
3: 4
4: 65
Right 928615525 2:33035089-33035111 TCCCCTTGTTGCCGATGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 44
928615518_928615525 9 Left 928615518 2:33035057-33035079 CCTTTCTTTGGATGCCGTAGCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 928615525 2:33035089-33035111 TCCCCTTGTTGCCGATGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928615525 Original CRISPR TCCCCTTGTTGCCGATGGAT AGG Intronic
902962714 1:19976238-19976260 TCCCCTTGTTGCTCATTGGTTGG - Intronic
906704113 1:47882236-47882258 TCCCCATGCTGCCGTTGCATGGG + Intronic
909839588 1:80302498-80302520 TCCCCATGTTTCCTATGCATGGG + Intergenic
917581041 1:176378190-176378212 TCCCCTTGTTGCTTTAGGATAGG - Intergenic
920283826 1:204864961-204864983 TCACCTTGTTGCTGGTGCATTGG + Intronic
920818279 1:209355916-209355938 TCACCTTGTTACTTATGGATGGG + Intergenic
1068881237 10:62051168-62051190 TCCCCTGGTTGCCGTGGGCTGGG + Intronic
1069622426 10:69846201-69846223 GCCCCTTGTTACCGAGGGCTGGG - Intronic
1070784939 10:79157497-79157519 TCCCCTTGTTGTCCATGGGGAGG + Intronic
1099066928 12:77992589-77992611 TTCAGTTGGTGCCGATGGATGGG + Intronic
1100357796 12:93848470-93848492 TCCCTGTGATGCTGATGGATGGG + Intronic
1101816721 12:108151350-108151372 TCCCCTTGATGCAGGTGGAGAGG + Intronic
1107660770 13:42636958-42636980 TCCCCGTTGTGCCTATGGATAGG - Intergenic
1122690378 14:103529379-103529401 GCCCCTTGTTGCCTCTGCATCGG + Intronic
1125807306 15:42504841-42504863 TCCTCTTGCTGCGGATGCATTGG + Intronic
1129396112 15:75247963-75247985 TGTCCATCTTGCCGATGGATGGG + Intergenic
1134831156 16:17324152-17324174 TTCCCTTGTTGTCTCTGGATTGG - Intronic
1137352566 16:47726428-47726450 TCCCCGTGGTGCCTCTGGATGGG + Intergenic
1141054935 16:80805024-80805046 TCCCCATGGTGCCTCTGGATGGG - Intergenic
1141906276 16:87028958-87028980 TCTGCCTGATGCCGATGGATGGG - Intergenic
1143335449 17:6168716-6168738 TCCACTTTTTGCTGACGGATGGG + Intergenic
1144950028 17:18989062-18989084 TCCCCTTGCTGCCAAGGGACAGG - Intronic
1148944179 17:51244445-51244467 TCCCCTTGTTGCCAGTGCAGTGG + Intronic
1168012250 19:53542645-53542667 CCCCCTAGTTGCTGATGGAAAGG + Intronic
927993035 2:27461585-27461607 TCCCCTTGTTATAGAGGGATTGG - Intronic
928615525 2:33035089-33035111 TCCCCTTGTTGCCGATGGATAGG + Intronic
929231704 2:39567069-39567091 TCCCACTGTTGCAAATGGATGGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
948620435 2:239231298-239231320 TCCCCTTTTGGCCGATGGAAGGG + Intronic
1169743267 20:8918118-8918140 TCCCCATTTTCCCCATGGATAGG + Intronic
1182142103 22:27968339-27968361 TCCCCTTCCTGCCCATGGTTTGG - Intergenic
1182488038 22:30650959-30650981 TCCCCTGGTGGCCCTTGGATTGG + Intronic
952222933 3:31342582-31342604 TCCCCTGCTTTCCTATGGATTGG - Intergenic
969143943 4:5103539-5103561 TTCCCTTATTGATGATGGATGGG + Intronic
975283070 4:72585448-72585470 TCCCATTGATGCAGATGAATTGG + Intergenic
976768612 4:88625719-88625741 TCACCTTGTTCCTGATGAATAGG + Intronic
985584012 5:717900-717922 TCCCATTGTTGCCTATAGTTTGG - Intronic
985597515 5:802200-802222 TCCCATTGTTGCCTATGGTTTGG - Intronic
993634381 5:90326342-90326364 TGCCCCTGTTGCCTAAGGATTGG - Intergenic
1005714921 6:28537876-28537898 TACACTTGTTGCCGAGGTATTGG - Intergenic
1023545924 7:41317654-41317676 TCCCTTTGTGGCGGATGGAATGG + Intergenic
1034353227 7:150430700-150430722 TCCCCTTGGTGCAGATGCAGTGG + Intergenic
1035099211 7:156382555-156382577 GCCCCGTGTTGCCCATGGATTGG - Intergenic
1049476176 8:142797911-142797933 TGCCCGTGGTGCCGATCGATGGG - Intergenic
1061112521 9:128584891-128584913 TCCCCTTCTTGCCGAGGGCATGG + Intronic
1062000912 9:134215241-134215263 TCCCTTTGTTCCCGAGGGAGGGG - Intergenic
1191224671 X:58030888-58030910 TGCCCTTGCTGCCTTTGGATGGG - Intergenic
1192756324 X:74049866-74049888 TGCCCTTGCTGCCCTTGGATTGG + Intergenic