ID: 928620632

View in Genome Browser
Species Human (GRCh38)
Location 2:33084396-33084418
Sequence GCTGCTGGTGGGAGGCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928620620_928620632 13 Left 928620620 2:33084360-33084382 CCATGAAGCAGACAGGGTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 197
Right 928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928620632 Original CRISPR GCTGCTGGTGGGAGGCGTCC TGG Intronic
900117448 1:1034606-1034628 CCTGCTGGTGCGAGGCTTCATGG + Intronic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900587870 1:3442089-3442111 CCTGCTGGTGGAAGGGGTCCGGG + Intergenic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
900701909 1:4053772-4053794 GCTTCTGGTGGCAGGCACCCGGG - Intergenic
900763143 1:4486410-4486432 GATCCTGGTGAGAAGCGTCCCGG - Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901109630 1:6784913-6784935 GCTGCTGGCGCGTGGGGTCCCGG - Intergenic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
901916904 1:12507066-12507088 GCTTCTGGTGGGAGGGGCCGGGG - Exonic
902378324 1:16040794-16040816 GATGCTGGCGGGATGCTTCCGGG - Intergenic
902455963 1:16534373-16534395 GCCGCTGCTGAGAGGCGGCCTGG - Intergenic
902496206 1:16873538-16873560 GCCGCTGCTGAGAGGCGGCCTGG + Intronic
902701513 1:18175573-18175595 GCTCCTGGTGGGAAGTGACCCGG + Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
903684108 1:25118766-25118788 GATGCTCGTGGGAGGCCTCCTGG + Intergenic
905440098 1:37990164-37990186 CCTGCTGGTGGGAGGTGTGGTGG + Exonic
906608088 1:47184914-47184936 GCTGCTGGGGGGAGGTGGCTGGG - Intronic
909818475 1:80027639-80027661 TCTGCTGGTGGGTGGCTTGCTGG - Intergenic
914908146 1:151763398-151763420 GCTGCTTCGGGGAGGCGTCCAGG - Exonic
915214406 1:154330231-154330253 GCTGCTGGTGAGAGGTGGACTGG + Intronic
915535024 1:156530299-156530321 GCTGCTTGTGGGCTGCTTCCTGG + Exonic
915915845 1:159940435-159940457 GCAGGTGGAGGGAGGCCTCCAGG - Intronic
918154353 1:181831173-181831195 GCTGCTGGAGGGTGGGGTCCAGG - Intergenic
919378496 1:196824138-196824160 GCTGGGGGTGGGTAGCGTCCTGG - Intronic
919786457 1:201261432-201261454 GCTCCTGGTGGGTGGGGTTCTGG - Intergenic
919844406 1:201632300-201632322 GCTGCTGGTGGATGGCCTTCAGG - Intronic
920774953 1:208927060-208927082 TCTGCTGGTTGGAGGCATCCAGG - Intergenic
922179769 1:223224608-223224630 GTTGCTGGTGTGAGGGCTCCAGG + Intronic
922875093 1:228934208-228934230 GCTGCTTGTGGGAAGTTTCCTGG - Intergenic
924031388 1:239889113-239889135 TCTGCTGGAGAGAGGGGTCCTGG + Intronic
1063705915 10:8430688-8430710 CCTGCTGCTGGGAGGAGACCTGG + Intergenic
1067722878 10:48743057-48743079 GCTCCTGGAGGGAGCCTTCCAGG - Exonic
1067825968 10:49573036-49573058 GTTACTGGTGGGAGGTGTCTAGG + Intergenic
1069931912 10:71888763-71888785 GCTGGAGGTGGGAGGCGCTCGGG + Intergenic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1070812735 10:79306419-79306441 GCTGATGGTGGCAGGGGTCGGGG + Intronic
1071257399 10:83883839-83883861 GGGCCTGGTGGGAGGTGTCCAGG + Intergenic
1072737439 10:97888717-97888739 GCTGCTGGTGTGCGGTGTCTGGG - Intronic
1073178747 10:101571314-101571336 CCTGCTGGAGGCAGGGGTCCGGG - Intronic
1073217268 10:101843502-101843524 GCTGGTCGTAGGAGCCGTCCAGG + Exonic
1076136305 10:128047400-128047422 GCAGCGGCTGGGAGGCGCCCGGG - Exonic
1077048486 11:556248-556270 GCAGCTGGTGCGCGGCTTCCCGG - Exonic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1079182357 11:18204799-18204821 GCTGGTGGTGGCAGGCATTCTGG - Intronic
1080531288 11:33179161-33179183 GTTACTGGTGGAAGGTGTCCAGG + Intergenic
1082768612 11:57188098-57188120 GCTGCTGGTGGAAGGAGGCCAGG - Exonic
1082811068 11:57479364-57479386 GCTGGTGGTGGGAGGGGTGGGGG - Intergenic
1083593137 11:63906830-63906852 GCTGCTGGTGGCAGGGGTGCTGG - Intronic
1083854679 11:65386865-65386887 GGCGCTGGTGGGAGGGGTGCGGG - Intronic
1084620817 11:70269400-70269422 GCTGTTGGTGTGAGGCAGCCAGG - Intergenic
1084650758 11:70487949-70487971 GCTGCTGCTGTGGGGCCTCCAGG + Intronic
1085163997 11:74379350-74379372 GGTCCTGGTGGGAGGCGTTTGGG - Intronic
1085393782 11:76195959-76195981 GCTTCTGGTGGGGGGAGTCTGGG - Intronic
1085473644 11:76774177-76774199 GGTGGTGGTGGGAGGAGGCCAGG - Intergenic
1085708938 11:78811975-78811997 GTTGCTGGTGGGTGGGCTCCTGG + Intronic
1087808929 11:102589236-102589258 GGTGCGGGTGGGTGGCTTCCAGG - Intronic
1088089495 11:106021858-106021880 GTTGCTGCTGGTAGGAGTCCCGG + Exonic
1088743463 11:112785442-112785464 AGTGGTGGTGGGAGGAGTCCAGG - Intergenic
1088871972 11:113898199-113898221 ACAGCTGGTGGGAGGGGTCCTGG + Intergenic
1089492618 11:118893365-118893387 GCTGATGAAGGGAGGCGTGCGGG - Intronic
1091301491 11:134510738-134510760 GCTGCGTGTGGGAGGGGACCAGG - Intergenic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG + Intergenic
1094230982 12:28103112-28103134 GCTGCTTCTGGGAGGCCTCAGGG + Intergenic
1096557271 12:52411148-52411170 CCTGCTGGTGGGAGTTGTCAGGG + Intergenic
1096637716 12:52971658-52971680 GCTGATGGTGGGAGGGTCCCAGG + Intergenic
1097236964 12:57546932-57546954 GCTGCAGGCGGGAGGGGTCGCGG + Intronic
1097279527 12:57836085-57836107 GATGATGGTGGGAGGGCTCCTGG - Intronic
1098963605 12:76763913-76763935 GCTGCCCGGGGGAGGCGGCCGGG - Exonic
1100099455 12:91085861-91085883 CCTGTTGGTGGTAGGGGTCCGGG - Intergenic
1101751295 12:107584676-107584698 GTTCCTGGTGGGAGGCAGCCTGG + Intronic
1102165399 12:110802088-110802110 GCCACTGGTGGGGGGCTTCCTGG + Intergenic
1102461720 12:113104084-113104106 GCAGCGGGTGGGAGGCGATCAGG + Intronic
1102480929 12:113222470-113222492 ATTGCTGGTGGGTGGAGTCCAGG - Intronic
1103177784 12:118879533-118879555 GGTCCTGGTGGGAGGTGTCTGGG - Intergenic
1103986254 12:124769506-124769528 GCTCCTGGAGGGTGGTGTCCTGG + Intergenic
1104063666 12:125288731-125288753 GCATCTAGTGGGAGGAGTCCAGG - Intronic
1104120443 12:125793943-125793965 GCAGCTGGTGGGCAGAGTCCTGG - Intergenic
1104284977 12:127417021-127417043 TCTGATGTAGGGAGGCGTCCAGG - Intergenic
1104961432 12:132490208-132490230 GCGGCAGGCGGGAGGCGGCCGGG - Exonic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1108624189 13:52211236-52211258 CCTGCTGGTGAGAGGCGCCCAGG - Intergenic
1108661863 13:52595187-52595209 CCTGCTGGTGAGAGGCGCCCAGG + Intergenic
1112065923 13:95793018-95793040 GCAGCAGGTGGGAGGTGGCCAGG - Exonic
1114092561 14:19302536-19302558 GCTTCGGGTGGGAGCCGGCCCGG + Intergenic
1115713201 14:36073083-36073105 GCTGCTGGTGTGCGGCCTGCTGG + Intergenic
1118637811 14:67763981-67764003 GCTGCTGGGTGGAAGCATCCTGG + Intronic
1119027322 14:71164431-71164453 TCTGCTGGTGGGAGGCGGGGTGG + Intergenic
1119992729 14:79217430-79217452 GGGCCTGGTGGGAGGTGTCCGGG - Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1121180688 14:91926297-91926319 GCTGCTGGAGGGAGGCTGTCTGG + Intronic
1121653484 14:95576895-95576917 GTTACTGGTGGAAGGTGTCCAGG + Intergenic
1122634822 14:103124887-103124909 GCTGGGGGTGGGAGGAGCCCAGG + Intronic
1122688411 14:103520752-103520774 TCTCCTGCTGTGAGGCGTCCCGG - Intronic
1122707292 14:103629267-103629289 GCTGCTGGTGCGAGGAGCCGCGG + Intronic
1122864454 14:104597237-104597259 GCTGCTGGTGGGGGTTGCCCAGG - Intronic
1123089221 14:105734690-105734712 GCTGCTGGAGGGTGGGCTCCAGG - Intergenic
1202849807 14_GL000225v1_random:9395-9417 CCTGCTGCGGGGAGGCCTCCGGG - Intergenic
1202868115 14_GL000225v1_random:136042-136064 CCTGCTGCGGGGAGGCCTCCGGG + Intergenic
1124469161 15:29968377-29968399 GGTGCGGGTGCCAGGCGTCCCGG + Intronic
1125767275 15:42144115-42144137 GCTGGTTGGGGAAGGCGTCCGGG + Exonic
1127734661 15:61829717-61829739 GCTGATGGTGGCAGGCTTCATGG - Intergenic
1129198596 15:73985384-73985406 GCTGCTGGAGGGTGCTGTCCAGG + Exonic
1129968168 15:79755330-79755352 GTTGGTGGTGGAAGGGGTCCAGG + Intergenic
1130776732 15:86992075-86992097 GCTTCTGGTGAGAGGCCTCAAGG + Intronic
1131075021 15:89490121-89490143 CCTCCTGGTGGGAGGCGGACTGG - Intronic
1131262632 15:90895651-90895673 GATGCTGGTGGCAGGAGTCCAGG - Exonic
1131838278 15:96411267-96411289 GTTGCTGGGGGGAGGTGTCACGG - Intergenic
1132088772 15:98930296-98930318 GCTGCTGATGGTAAGAGTCCGGG + Exonic
1132117872 15:99150841-99150863 GTTGCTGGTGGGAGAGGTGCAGG - Intronic
1132331276 15:101013880-101013902 CCTCCTGGTGGGTGGCCTCCTGG - Intronic
1132579288 16:677746-677768 GCGGCAGGTGGGAGGTGCCCTGG - Intronic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132657077 16:1045875-1045897 ACTGCTGCAGGGAGGGGTCCGGG + Intergenic
1132667589 16:1089271-1089293 GCTGCTGGGGGTGGGGGTCCCGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133001113 16:2852255-2852277 GGTGGTGGAGGGAGGCGCCCAGG - Intergenic
1133027615 16:2995535-2995557 GCTGCTGGGAGGAAGCCTCCAGG + Intergenic
1134606509 16:15575524-15575546 GTTACTGGTGGAAGGTGTCCAGG + Intronic
1135302698 16:21344783-21344805 GCTGCTGGGAGGAGCTGTCCAGG + Intergenic
1135587095 16:23679600-23679622 GGTGCTGGGGGGAGGGGTGCTGG + Intronic
1136299457 16:29323999-29324021 GCTGCTGGGAGGAGCTGTCCAGG + Intergenic
1138492864 16:57386617-57386639 GTTGCTGGTGGGTGGTGTGCAGG - Intergenic
1138564604 16:57824053-57824075 CTTGCTGGTGGCAGGCTTCCAGG + Intronic
1138583902 16:57958356-57958378 GGTGGTGGTGGGAGGGGTCTTGG - Intronic
1139922751 16:70470239-70470261 TCTGCTGCTGGGAGGCAGCCTGG + Intronic
1140797350 16:78451634-78451656 GCTGTTGGTGGGAGGTGTGCAGG + Intronic
1141594137 16:85087182-85087204 GCTGCTGGCAGGAGGCGGGCAGG + Intronic
1142380712 16:89730414-89730436 GCTGCTGGTGTGAGGAGGGCTGG + Intronic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1143513049 17:7406300-7406322 GGAGCTGGTGGGAGGAGGCCAGG + Intronic
1143681951 17:8482228-8482250 GCAGCTGGTGGGAAGAGCCCTGG - Intronic
1144149717 17:12431492-12431514 GCTGCAGGTGGAAGGAGTACAGG - Intergenic
1146398460 17:32486620-32486642 GCTGCTGTTGGGCGGCGGCGCGG + Exonic
1148104475 17:45112134-45112156 GGAGCTGGAGGGAGGAGTCCAGG + Exonic
1148157082 17:45430741-45430763 TCTGCGGGCGGGAGGCTTCCAGG - Intronic
1148646894 17:49224392-49224414 GCTGCTGGCGGGCGGCGACGTGG - Exonic
1148739981 17:49887311-49887333 GCTGCTGGTGGGGGGTGTGCAGG + Intergenic
1149474693 17:56950130-56950152 GCTGCTGGATGGAGGCGTTCTGG - Exonic
1149683533 17:58521704-58521726 GCTGGTGGTGGGAGGGGATCAGG - Intronic
1150285409 17:63951136-63951158 CCTGCTGGTGAGAGGGGCCCAGG + Intronic
1150388786 17:64779526-64779548 GCTCCTGGAGGGAGGCGTCCAGG - Intergenic
1150790672 17:68198438-68198460 TCTGCGGGCGGGAGGCGTCCAGG + Intergenic
1151492410 17:74440430-74440452 GCTGCTGCTGGGTGCCTTCCTGG + Exonic
1151599508 17:75097653-75097675 TCTGTTGGTGGGAGGAGTCGGGG - Intronic
1152260370 17:79263505-79263527 GCTGCTCGTGGCAGAAGTCCTGG + Intronic
1152312113 17:79557770-79557792 GCATCTCGTGGGAGGCCTCCTGG + Intergenic
1152753493 17:82077435-82077457 GCTGCAGGTGGGCAGTGTCCAGG - Intergenic
1152753959 17:82079208-82079230 GCTGCTGGAGGGCAGCGGCCTGG - Exonic
1153666395 18:7370583-7370605 GCTGCTGATGGGAGGGGGCGGGG + Intergenic
1154251287 18:12747179-12747201 TCTGCTGGTGGATGGCGGCCAGG - Intergenic
1154975637 18:21454901-21454923 CCTGCAGGTGGGAGGAGTTCAGG - Intronic
1155170801 18:23265643-23265665 GCAGCTGTTGGGAGGGGTCTGGG - Intronic
1155540346 18:26863253-26863275 GCTGCCAGCGGGAGGAGTCCGGG + Intronic
1157357747 18:46951080-46951102 ACTGATGGTGGGAGGAGGCCAGG - Intronic
1157449071 18:47772133-47772155 GCTTCTGGTGGGTGGAGTCCAGG - Intergenic
1157590403 18:48833276-48833298 GCTGCAGGCGGGAGGCCTCGTGG + Intronic
1157600360 18:48889647-48889669 CCAGCTGGCGGGAGGCGTCTCGG + Intergenic
1157727259 18:49974381-49974403 GCTGCTTGAGGGAGGTGTGCAGG + Exonic
1157877541 18:51287735-51287757 GCAGCTGAGGAGAGGCGTCCAGG - Intergenic
1159131166 18:64281600-64281622 GCTGCAGGTGGGAGGGGGGCAGG + Intergenic
1160468850 18:79108076-79108098 GCTGTTGGTGGGAGGAGTTGGGG + Intronic
1161207229 19:3047351-3047373 GCGGGTGGCAGGAGGCGTCCTGG - Intronic
1161236739 19:3201950-3201972 GCTGGGGGTGGGGGCCGTCCTGG + Intronic
1161249671 19:3273763-3273785 GCTGGTGGTGGGAGGTGGGCAGG + Intronic
1161354462 19:3811136-3811158 GAAGCTGATGGCAGGCGTCCCGG + Intronic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1162064587 19:8117319-8117341 GGGGCTGGGGGGAGGGGTCCAGG + Intronic
1162477278 19:10908167-10908189 GCTGCCGGGGGGAGGCGGCCTGG - Intronic
1162923721 19:13919084-13919106 GCTGCCTGTGGGAGGGCTCCCGG - Intronic
1163186994 19:15645783-15645805 GCTGCTGGTGGGTGGGGCCCTGG + Exonic
1163217795 19:15893795-15893817 GCTGCTGGTGGGTGGGGCCCTGG - Intronic
1163255405 19:16153139-16153161 TCTGCTGGTGGAAGGTGACCAGG - Exonic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1163747482 19:19056939-19056961 GCTGGTGGTGGGAGCCACCCTGG + Intronic
1164283429 19:23789295-23789317 GCTGCTGGTGGCAGGCAGACTGG - Intronic
1164522469 19:28989697-28989719 GCTCCTGGAGGGTGGCCTCCAGG + Intergenic
1165820861 19:38675129-38675151 GTTGCTGGTGGGAGATGCCCAGG + Intronic
1165997952 19:39858477-39858499 GTTGCCGGTGGAAGGTGTCCAGG + Intergenic
1166295723 19:41888330-41888352 TCTGCAGGTGGGAGGGGACCTGG - Intronic
1166781979 19:45347760-45347782 CCAGCTGGTGGGATGCATCCTGG - Intronic
1167210414 19:48130670-48130692 GTTGTGGGTGGGAGGTGTCCAGG + Intronic
1167613272 19:50517480-50517502 GCTGTGGGAGGGAGGGGTCCCGG + Exonic
1167946498 19:52992949-52992971 GGTGAGGGTGGGAGGCGCCCAGG + Intergenic
1168275175 19:55274035-55274057 GCATCTGGTGGGTGGCCTCCAGG - Intronic
1168406981 19:56115640-56115662 GGTGCGGGTGGGAGGCATGCGGG - Intronic
1202706850 1_KI270713v1_random:30729-30751 GCCGCTGCTGAGAGGCGGCCTGG - Intergenic
924987754 2:287697-287719 GCTGGTGGTGGAACTCGTCCAGG - Exonic
926023467 2:9517635-9517657 GCTGCAGGTCAGAGGGGTCCAGG + Intronic
926107190 2:10159891-10159913 GCTGGAGGTGGGAAGCGCCCAGG + Intronic
926310262 2:11669865-11669887 GCTGCTGCTGGTCGGCGTGCCGG - Exonic
927023213 2:19039338-19039360 GCTGCTGGTAGAAGGGGTGCTGG + Intergenic
927521316 2:23700097-23700119 GCTGATGATGGAAGGCTTCCAGG - Intronic
928363907 2:30687262-30687284 GCTGCTGGTGAGAGCCCTCTGGG + Intergenic
928471391 2:31580314-31580336 CCTGCGGGCGGGAGGCGACCTGG - Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929538979 2:42805121-42805143 GCTGCCAGTGGGCGGCTTCCCGG - Intergenic
930158512 2:48129409-48129431 GCTGTTGGAGGGTGGAGTCCAGG + Intergenic
931856035 2:66302522-66302544 GCTGCTGGTGGTAGCTGTGCTGG - Intergenic
933858598 2:86441963-86441985 GCGGCCGGTGGGAGGGGGCCGGG - Intronic
933900566 2:86846723-86846745 CCTGCTGGTGGCTGGCGTCCTGG - Exonic
934899693 2:98149243-98149265 GTTACTGGTGGAGGGCGTCCAGG + Intronic
934949564 2:98567166-98567188 GAGGCTGCTGGGAGGAGTCCAGG + Intronic
935779982 2:106502502-106502524 CCTGCTGGTGGCTGGCGTCCTGG + Intergenic
937854415 2:126662001-126662023 GCAGCGGGTGTGAGGCGCCCTGG - Intronic
938018270 2:127885636-127885658 GCAGCGGGGGGGAGGAGTCCCGG - Intronic
938487338 2:131724147-131724169 GCCGCCGCTGGGAGGCGGCCTGG - Intronic
940769987 2:157829373-157829395 ACTGCTGGTGGGAGAGGTCCTGG - Intronic
941974378 2:171386909-171386931 TCTGCTGGTGGGTGGCCTGCTGG - Intronic
942346109 2:175004846-175004868 GCCGCAGGTGGGCCGCGTCCCGG - Intronic
942408959 2:175686230-175686252 GGTGCTGCTGTGAGGCGTCAAGG - Intergenic
946389896 2:219408947-219408969 GCTGCTGGAGGGAGGGGCTCTGG + Intergenic
946689495 2:222299655-222299677 GCTCCTCCTGGGAGGAGTCCAGG + Intronic
948454915 2:238100479-238100501 GCTGCTGGAGGCTGGCGCCCTGG + Exonic
948536645 2:238652003-238652025 GGGGCTGGTGGGAGGTGTCTGGG - Intergenic
948983880 2:241508489-241508511 GCTGCGGGTGGGAGCCTTCGCGG - Exonic
1169090528 20:2858857-2858879 GATGGTGCTGGGAGTCGTCCTGG - Intronic
1170108238 20:12775577-12775599 GGTACTATTGGGAGGCGTCCTGG - Intergenic
1171367377 20:24634853-24634875 GTTGCTGGAGGGAAGCTTCCAGG + Intronic
1172167195 20:32906656-32906678 GCTGCTGGGGGGAGGGCTGCTGG + Intronic
1172273466 20:33667362-33667384 CCTGCTGGTGGGCGGCCTGCGGG + Exonic
1173926989 20:46788078-46788100 GCTGCAGTTGGGAGGAGACCTGG - Intergenic
1174657443 20:52183335-52183357 CCTGCGTGTGGGAGGCTTCCAGG - Intronic
1175339586 20:58219755-58219777 GCTGCTGGGGGGAGGTGTCATGG - Intronic
1175346037 20:58276784-58276806 GCTGCTGGTGGGTGGAAGCCAGG - Intergenic
1175778706 20:61668881-61668903 GGTGCTGGTGGAAGGCACCCGGG - Intronic
1175969301 20:62675790-62675812 GCTGGCTGTGGGAGGCATCCAGG - Intronic
1176447415 21:6831831-6831853 GGTGTTGGTGGGCGGAGTCCGGG + Intergenic
1176825583 21:13696857-13696879 GGTGTTGGTGGGCGGAGTCCGGG + Intergenic
1177894603 21:26844702-26844724 GCTGCTGGTCAAAGGCGTGCAGG + Exonic
1178914642 21:36699571-36699593 GCGGCTGCGGGGAGGCGTCTCGG + Exonic
1179415526 21:41195356-41195378 GCTGCAGATGGGAGATGTCCAGG + Intronic
1179417927 21:41213303-41213325 GCTGCAGCTGGGAGGCCTTCTGG + Intronic
1179435673 21:41360570-41360592 GCTGCTGGTGAGGGGCGTGCAGG + Intergenic
1180233171 21:46440149-46440171 GCAGCTGGTGGAAGCCGGCCGGG - Exonic
1180488168 22:15820030-15820052 GCTTCGGGTGGGAGCCGGCCCGG - Intergenic
1180817302 22:18798998-18799020 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1180945267 22:19689045-19689067 GCTGCGGGTGTGGGGCATCCAGG + Intergenic
1181187923 22:21119596-21119618 GCTGCTGGTGGGAGGTCTTTGGG - Intergenic
1181203492 22:21233319-21233341 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1181211275 22:21290897-21290919 GCTGCTGGTGGGAGGTCTTTGGG + Intergenic
1181500967 22:23315360-23315382 GCTGCTGGTGGGAGGTCTTTGGG - Intronic
1181882563 22:25992525-25992547 GCAGCAGGTGGGCGGCATCCTGG + Intronic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
1183441481 22:37825389-37825411 GCTGCTGGCTGGTGGCGGCCAGG + Exonic
1184225409 22:43126871-43126893 GATGCGGGTGGGAGGGGTACAGG - Intronic
1185098783 22:48826462-48826484 GCTGTTGGTGGGAGGCTCCTGGG - Intronic
1185134655 22:49062755-49062777 GACGCTGGTGGGAGGAGGCCAGG + Intergenic
1185229486 22:49671951-49671973 GATGCTGGTGAGGGGGGTCCCGG + Intergenic
1203215674 22_KI270731v1_random:4534-4556 GCTGCTGGTGGGAGGTCTTTGGG - Intergenic
1203223429 22_KI270731v1_random:62095-62117 GCTGCTGGCAGGAGGCCTCATGG + Intergenic
1203267401 22_KI270734v1_random:24725-24747 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1203274952 22_KI270734v1_random:80857-80879 GCTGCTGGTGGGAGGTCTTTGGG + Intergenic
949226312 3:1699810-1699832 GCTGATGGTGGGAGGCAGACAGG + Intergenic
949702679 3:6777175-6777197 GCTGGTGGAGGGAGCCCTCCGGG - Intronic
950249212 3:11449989-11450011 GCAGGGGGTGGGAGGAGTCCTGG + Intronic
950412053 3:12845030-12845052 GTTACTGGTGGAAGGTGTCCAGG + Intronic
950421224 3:12901019-12901041 GCTGCTGGTGGGGGGCGGCGGGG + Intronic
952897038 3:38084705-38084727 ACTGCTGATGGGGGGAGTCCAGG - Intronic
953913114 3:46902692-46902714 GCTGAGGGTGGGAGGGGTTCCGG + Intronic
955898527 3:63726647-63726669 GCAGCTGGTGGGTAGAGTCCGGG + Intergenic
960702472 3:120451294-120451316 GCTGCTGGCTGGCGGCGGCCCGG + Intergenic
960960402 3:123066987-123067009 GCAGCTGGGGAGAGGCGGCCGGG - Intergenic
961353400 3:126318077-126318099 GCAGCTGGGTGGAGGCGTCCAGG - Intergenic
961885016 3:130091369-130091391 GCTGAGGGTGGGAGGCCTACCGG - Exonic
962578758 3:136778404-136778426 GATGCTGGTGGGAGTCCTCATGG - Intergenic
962854013 3:139328403-139328425 GCTGCTGGAGGGACCTGTCCAGG + Intronic
962889519 3:139658931-139658953 GCTGCTTGAGGGAGGGGTGCAGG - Intronic
966520700 3:180870379-180870401 GCTCCTGGTGGGATGGGTACTGG + Intronic
966902814 3:184499483-184499505 GCTGCTGGATGGAGGCGTCTAGG - Intronic
968602564 4:1517262-1517284 GCTGCTGGTGGGCGGAGGGCTGG - Intergenic
968613893 4:1568795-1568817 GCTGCGGGTCGGAGGCGGCGCGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969046455 4:4340117-4340139 CCTGCTGGAGGGAGGGGTGCAGG - Intergenic
969319426 4:6402791-6402813 ACTGCTAGTGGGAGGCATTCAGG + Intronic
970996120 4:22269076-22269098 GCTGGTGGTGGGTGGAGCCCTGG - Intergenic
975760293 4:77613466-77613488 GCAGCTGGTGGGTGGCGTGAAGG + Intergenic
975983483 4:80183876-80183898 GCTGCTGCCGGGCGGCGTCTGGG - Intronic
976105448 4:81612413-81612435 CCTGTTGCTGGGAGGCTTCCAGG + Intronic
980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG + Intergenic
982396080 4:154917419-154917441 GCTGCAGGTGGTAGGTTTCCAGG - Intergenic
983904335 4:173168871-173168893 GCTGGTGGTGGGAAGCTTCCTGG + Exonic
985486907 5:156918-156940 GCTGCAGGAGGAAGGCGGCCCGG + Intronic
985611401 5:891596-891618 GCTCCTCGTGGGCAGCGTCCGGG + Intronic
985791481 5:1930802-1930824 GCAGCTGCTGGGCGGCCTCCCGG + Intergenic
986456520 5:7926349-7926371 GCTGCTGGTGGAATGCCCCCTGG + Intergenic
986858810 5:11903728-11903750 GCCGCTGGTGGGGGTGGTCCTGG - Intronic
988683013 5:33502182-33502204 GCCGCCGCTGGGAGGCGGCCTGG + Intergenic
989780687 5:45262000-45262022 GCTGCTGGTGGAGGGGGTGCTGG + Exonic
997298603 5:132785654-132785676 GCTGCTGCTGGGAGGAATCCAGG + Intronic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
998498435 5:142611290-142611312 TCTGCAGGTGAGAGGAGTCCTGG - Intronic
1001094770 5:168767707-168767729 GGTGGTGGTGGGAGGGGTCGGGG + Intronic
1002060080 5:176620784-176620806 GCTGCTGGTGGGGGCTCTCCTGG + Exonic
1002338246 5:178495187-178495209 GCTGCTGATGGGCGGGGTGCAGG - Intronic
1002348210 5:178562728-178562750 GCTGGTGGTGGGGGGGGTGCGGG + Intronic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1004521223 6:16362570-16362592 GCTGCTGGTGGGAAGAGCCGTGG - Intronic
1006084773 6:31587865-31587887 CCTGCTGGTGGGGGGAGCCCGGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1007231431 6:40349955-40349977 GCTCCTTGTGGGAGTTGTCCCGG - Intergenic
1007495754 6:42259492-42259514 GCAGCTCGTGGGTGGGGTCCAGG + Exonic
1007697124 6:43740905-43740927 GCTTCTGAGGGGAGGAGTCCTGG + Intergenic
1008535696 6:52504720-52504742 GCTGCTGGTGTGTGCCGCCCAGG - Exonic
1013491009 6:110646396-110646418 GCTGCTGGCGGGCGGCGACATGG + Intronic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1018580336 6:165302476-165302498 GCTGCAGATGAGAGGCGCCCAGG + Intronic
1018710617 6:166495874-166495896 GCTGATGGTGGAAGGGGACCGGG + Intronic
1018975088 6:168558448-168558470 GCTGCTGCTGGGAGCCTCCCTGG + Intronic
1019094424 6:169567271-169567293 CCTGCAGGTGTGAGGAGTCCAGG + Intronic
1019420029 7:946480-946502 GGTGCTGCTGGGAGGGATCCAGG - Intronic
1019597844 7:1866584-1866606 GCTGCTGGTGTGAGACGCCACGG + Intronic
1019661635 7:2227471-2227493 TCTGCTGCTGGCTGGCGTCCAGG + Intronic
1020212442 7:6166693-6166715 GCTGCAGGTGGGAGGAAGCCTGG + Intronic
1020778727 7:12491493-12491515 GCTGCTTCTGGGAAGCGTTCTGG + Intergenic
1021788795 7:24179025-24179047 GCTGCTGGTGTGAGCTGCCCTGG + Intergenic
1024329223 7:48139773-48139795 GCTAATGGTGGAAGGTGTCCAGG + Intergenic
1026828732 7:73599263-73599285 GTTGCTTGTGGAAGGCTTCCTGG - Intronic
1026968505 7:74454454-74454476 TCTGGAGGTGGGGGGCGTCCCGG + Intronic
1029305235 7:99614656-99614678 GCTCCTGGTGGTAGGGGTACGGG - Intergenic
1029371832 7:100155284-100155306 GCTGCTGGTGGGAGAAGGACTGG + Exonic
1029463018 7:100706992-100707014 GCTGCTGGACGGAGGGGCCCGGG + Exonic
1029506486 7:100966497-100966519 GCTGCTGGCGCTGGGCGTCCGGG + Exonic
1029531307 7:101127147-101127169 GCTGCTGGAGGGGGGCGTGTGGG - Exonic
1032404219 7:131644100-131644122 TCTCCTGGATGGAGGCGTCCTGG - Intergenic
1033305008 7:140218800-140218822 GCTGCTGGTATGAGGCTCCCTGG + Intergenic
1034346482 7:150388447-150388469 GCTGATGCTGGGAGGCCTCCAGG + Exonic
1035283100 7:157789464-157789486 GAGGCTCGTGGGAGGCCTCCAGG + Intronic
1035360443 7:158310010-158310032 TCTGGTGGTGGGTGGCTTCCTGG - Intronic
1035716421 8:1758682-1758704 GATGCAGGTGGAAGGTGTCCAGG + Intronic
1036697985 8:10991284-10991306 GGTGCTGATGGGAGCTGTCCAGG + Intronic
1037788788 8:21919252-21919274 GGTGGGGGTGGGAGACGTCCAGG + Intergenic
1038324866 8:26565404-26565426 GCTGCTGGTGAGAGTAGTCCAGG + Intronic
1038423066 8:27445962-27445984 GCTGCTGGAGGGAGGTGGCCGGG + Intronic
1040516958 8:48143401-48143423 GGGCCTGGTGGGAGGCGTTCTGG + Intergenic
1048355924 8:133654046-133654068 GATTCTGGTGGGAGGCGTTGGGG + Intergenic
1048369694 8:133766702-133766724 GTTACTGGTGGAAGGTGTCCAGG - Intergenic
1049183212 8:141234205-141234227 GGTGCTGGTGGAAGGCAGCCTGG + Intronic
1049209556 8:141379209-141379231 GCTTCTGGTGGGAGGCGGTGGGG - Intergenic
1049388087 8:142354352-142354374 GCTGCTGGTGGGTGGTGCTCGGG - Intronic
1049519535 8:143080874-143080896 GCTGGAGGTGGGGGACGTCCTGG + Intronic
1049555368 8:143278826-143278848 GCAGCTGACGGGAGGCTTCCCGG + Intergenic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049671589 8:143872494-143872516 GCTGCTGGAGGTGGGCATCCTGG - Exonic
1049748529 8:144273052-144273074 GCTGCTTGTGGAGGGCGCCCGGG - Intronic
1049777705 8:144414131-144414153 GGTCTTGGTGGGAGGCGCCCTGG - Intronic
1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG + Intergenic
1052056286 9:23911164-23911186 GCTGCTGGTGGGAGGTGGGGAGG - Intergenic
1052575416 9:30283865-30283887 GGAGCTGGTGGGAGGAGCCCTGG + Intergenic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1053427122 9:38017447-38017469 GCAGCTTGTGGCAGCCGTCCTGG + Intronic
1056170433 9:83980074-83980096 TCCGCTTGAGGGAGGCGTCCTGG - Intronic
1056737929 9:89225714-89225736 GCTGCAGGAGGCAGGCGTCCAGG - Intergenic
1056798467 9:89675144-89675166 GCTGCTGATGGGAGGAGTCCTGG + Intergenic
1057908351 9:98999378-98999400 GAAGGTGGTGGGAGGGGTCCCGG + Intronic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1059407267 9:114108889-114108911 GGTGCTGGTGAGAGGCCTGCTGG + Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1061152300 9:128835853-128835875 GCTGCAGGTGGGCTGGGTCCTGG - Exonic
1061395424 9:130341148-130341170 GGTGCTGGTGGGAGAAGCCCTGG + Intronic
1061618696 9:131796756-131796778 GCTGTCGGTGGGGGGCCTCCTGG - Intergenic
1062121508 9:134836398-134836420 GGGCCTGGTGGGAGGCGTCTGGG - Intronic
1062145783 9:134988968-134988990 GCGCCTGGTGGGAGGTGTCTAGG - Intergenic
1062330943 9:136044731-136044753 GCTGCTGGTGGGAGCGGCCTCGG + Intronic
1062449785 9:136610586-136610608 CCTGCTGGTAGGAGGCCTCGGGG + Intergenic
1062597851 9:137307129-137307151 GCTGCAGCTGGCAGGGGTCCCGG - Exonic
1203521776 Un_GL000213v1:52700-52722 GGTGTTGGTGGGCGGAGTCCGGG - Intergenic
1185832351 X:3314330-3314352 GCACCTGGTGGGTGGAGTCCGGG - Intronic
1185871673 X:3669989-3670011 GCCGCTGGTGGGTGGAGCCCAGG + Intronic
1187392327 X:18894305-18894327 GCTGCTGGTGGAAGCCATCATGG - Exonic
1192507547 X:71698121-71698143 CCTGCTGGAGGGGTGCGTCCAGG + Intergenic
1192519149 X:71783431-71783453 CCTGCTGGAGGGGTGCGTCCAGG - Intergenic
1196778758 X:119363178-119363200 GTTACTGGTGGAAGGTGTCCAGG + Intergenic
1196856750 X:119991530-119991552 GCTGCTGCTGCGAGGGCTCCTGG - Intergenic
1200805263 Y:7427369-7427391 GCTTCTGGTGGGTGGAGCCCAGG - Intergenic