ID: 928622333

View in Genome Browser
Species Human (GRCh38)
Location 2:33103771-33103793
Sequence ATGCTACTCAACAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928622333_928622339 9 Left 928622333 2:33103771-33103793 CCATCCTGCTTGTTGAGTAGCAT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 928622339 2:33103803-33103825 CTTCTCAACAACTTGAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 172
928622333_928622340 13 Left 928622333 2:33103771-33103793 CCATCCTGCTTGTTGAGTAGCAT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 928622340 2:33103807-33103829 TCAACAACTTGAAGGCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 194
928622333_928622337 5 Left 928622333 2:33103771-33103793 CCATCCTGCTTGTTGAGTAGCAT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 928622337 2:33103799-33103821 CATCCTTCTCAACAACTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 142
928622333_928622341 14 Left 928622333 2:33103771-33103793 CCATCCTGCTTGTTGAGTAGCAT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 928622341 2:33103808-33103830 CAACAACTTGAAGGCAGGCAGGG 0: 1
1: 0
2: 4
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928622333 Original CRISPR ATGCTACTCAACAAGCAGGA TGG (reversed) Intronic
902793695 1:18786305-18786327 CTGCAACCCAGCAAGCAGGAAGG - Intergenic
903678968 1:25084214-25084236 GTGCCACTCAACAGGCAGGAAGG + Intergenic
904864617 1:33568613-33568635 GTGCTACTCAAGGAGAAGGAAGG - Intronic
904969737 1:34409907-34409929 ATCCCACTCACCAAGCAGAAAGG + Intergenic
909086009 1:71171209-71171231 GTGGTACTCAACAAGTGGGAAGG - Intergenic
909888259 1:80969909-80969931 ATTATACTCATCAAGCAAGAAGG + Intergenic
913477539 1:119252887-119252909 ATGCTTCTCAACAAGCAGGCCGG + Intergenic
916002555 1:160630969-160630991 ATGCAAGGCAACAAACAGGAGGG - Intronic
920538426 1:206758143-206758165 AGGTTACTCAGAAAGCAGGACGG - Intergenic
922579062 1:226683566-226683588 ATACTACACAGCAAGCAGGAGGG - Intronic
923176296 1:231469326-231469348 ATCCTCCTCCAGAAGCAGGAAGG - Intergenic
923900951 1:238325921-238325943 ATTCTACTCAACAAATAGGAAGG - Intergenic
1063046518 10:2398087-2398109 AAGCTACTACAGAAGCAGGAAGG + Intergenic
1071557862 10:86619776-86619798 ATATTACTCACCAAGCATGATGG + Intergenic
1072011807 10:91308447-91308469 ATACTACTCAGCAATAAGGATGG - Intergenic
1075177306 10:120177369-120177391 CTGCTTCTCATCAAACAGGAGGG - Intergenic
1077992638 11:7425600-7425622 CTGCTACTCAGCAAGCATTAAGG + Intronic
1079668781 11:23140164-23140186 ATGATACTCAACCAGCAGCTTGG + Intergenic
1080395003 11:31882036-31882058 ATACTACTCTACAAACAGGAAGG - Intronic
1085880338 11:80459984-80460006 ATGCTGCTGAAGAAGTAGGAAGG - Intergenic
1086811222 11:91312621-91312643 AAGCTACTCATCGAGGAGGAAGG - Intergenic
1086931012 11:92693157-92693179 ATGATACTCAATAAGGAGGTGGG - Intronic
1089302125 11:117505004-117505026 GTGCAACCCAACAACCAGGATGG - Exonic
1089447438 11:118564921-118564943 ATGCTACTGAAAGAGCAGGATGG - Intronic
1096327644 12:50679232-50679254 ATTATAATCAAGAAGCAGGATGG - Intronic
1098169597 12:67733425-67733447 ATTTTACTCAAAAAGCAGGCAGG + Intergenic
1100695409 12:97087408-97087430 ATGCTTGGCAACAAACAGGAAGG - Intergenic
1103976227 12:124704673-124704695 CTGCCACTGAGCAAGCAGGAAGG + Intergenic
1108095404 13:46895484-46895506 ATGCCACTCACCATACAGGATGG + Exonic
1111129425 13:83955410-83955432 AGGCAACTCAGCAAGGAGGATGG - Intergenic
1112050550 13:95641389-95641411 AAGCTGCTCACCAAGCAGGCGGG - Exonic
1114839771 14:26249421-26249443 ATAATACTTAAAAAGCAGGAAGG + Intergenic
1116687022 14:48052754-48052776 ATGCTTCCCAACCTGCAGGATGG - Intergenic
1116875292 14:50105829-50105851 ATGCTACTCAAGAAGGAAGGGGG - Intergenic
1123640328 15:22398209-22398231 ATGCTGCTCAACAGGCTGCATGG + Intergenic
1129288301 15:74543240-74543262 AGTCCACTCAACAAGCAGGCTGG + Intronic
1131567532 15:93500290-93500312 ATGGCACTCAACTACCAGGAAGG + Intergenic
1138347361 16:56328305-56328327 CTCCAACTCAACCAGCAGGAAGG - Intronic
1138814889 16:60192527-60192549 AGGCAACTCAACAAGCGAGAAGG - Intergenic
1139059394 16:63230568-63230590 ATGCTGCTCAAGAAGCCGTATGG - Intergenic
1139167994 16:64593191-64593213 ATACTGCTCAACATGCAGGCAGG + Intergenic
1141377071 16:83541196-83541218 CTGATACTCAACAGGCAGCAGGG - Intronic
1141587424 16:85044063-85044085 ATGCCAGTCTACAAGCAAGAAGG - Intronic
1143355916 17:6328368-6328390 ATGTTTCCCAACAAGCAAGAAGG + Intergenic
1149033140 17:52105750-52105772 ATGCTAATCCACAATAAGGAAGG - Intronic
1152213006 17:79013131-79013153 ATGCTACACAACAAGTTGCATGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155166598 18:23237234-23237256 ACGCTACTCACCATGTAGGAAGG - Exonic
1156277005 18:35593271-35593293 GTGCTGCTGAACAGGCAGGAGGG + Intronic
1162694240 19:12459878-12459900 AAGCTACTCAGCAATCATGATGG + Intronic
1165757653 19:38303809-38303831 ACGCTGCTCACCAAGCCGGAGGG + Intronic
1167615106 19:50528730-50528752 ATGCTATTTCACAGGCAGGAGGG + Intronic
1167897763 19:52594812-52594834 ATGCTCCTCAAAAACCAGAACGG - Intronic
1167899704 19:52610582-52610604 ATGCTCCTCAAAAACCAGAATGG - Intronic
1167908144 19:52679307-52679329 ATGCTCCTCAAAAACCAGAATGG + Intronic
1168703256 19:58453885-58453907 ATCCTGCTCATCAACCAGGAGGG - Intronic
925618110 2:5763234-5763256 AGCCTACTCAACACCCAGGAAGG - Intergenic
925683414 2:6447023-6447045 TAGCTTCTCAAAAAGCAGGAAGG - Intergenic
928622333 2:33103771-33103793 ATGCTACTCAACAAGCAGGATGG - Intronic
930294538 2:49538165-49538187 AGGCTAGTCCTCAAGCAGGAAGG - Intergenic
931502646 2:62887171-62887193 ATTCTAGTCAACAAGAAGGAAGG + Intronic
934937290 2:98474554-98474576 CTGTCACTCACCAAGCAGGAGGG - Intronic
937085731 2:119170512-119170534 AAGCCACTCTACATGCAGGAGGG + Intergenic
937571883 2:123373396-123373418 ATCCTGCTCATCAAGCAGGGTGG + Intergenic
938753364 2:134356737-134356759 ATTCTACTCAAGAAACAGCAAGG - Intronic
940209204 2:151239171-151239193 ATACCACTCAACAATAAGGAAGG + Intergenic
944506511 2:200417921-200417943 AGTGTACTCAACAAGCAGTATGG - Intronic
947934620 2:233993277-233993299 AAGCTACTCTTCCAGCAGGAGGG + Intronic
949021838 2:241745155-241745177 AAGCTACTCAACCAACACGATGG - Intronic
1169637432 20:7707773-7707795 ATGCTGCTCTGAAAGCAGGAAGG - Intergenic
1170823494 20:19773733-19773755 ATGCACCTCAGCCAGCAGGAAGG - Intergenic
1171046544 20:21813518-21813540 ATGCTACTCAACAATAAAAAGGG - Intergenic
1173013319 20:39201952-39201974 ATGCAATGCAACAAGTAGGATGG - Intergenic
1179831092 21:43996556-43996578 ATTCTACTCAACAAATAGGAAGG - Intergenic
1180024817 21:45155015-45155037 ATGCTATTCAGACAGCAGGAGGG - Intronic
950196926 3:11015833-11015855 ATGCAACTCTACAAGCCAGAGGG + Intronic
959499099 3:107085098-107085120 ATGCTTCCCAGCCAGCAGGATGG - Intergenic
964472273 3:157068214-157068236 ATGCTGCTCAACATCCAGCAGGG + Intergenic
966366959 3:179199040-179199062 GTGTTACTCAAGAAGCAGAAAGG + Exonic
967318009 3:188168279-188168301 CTGCTACTGAACAAGCTGTACGG - Intronic
969583793 4:8080523-8080545 ATGCTTCTCACCCAGCAGCAGGG + Intronic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
970630816 4:17942336-17942358 ATGCTACAAAGCAAGCAGAAAGG + Intronic
971502356 4:27330885-27330907 ATGCTTCTCTACCAGCAGCAGGG + Intergenic
974896095 4:67940968-67940990 ATGCTTCTCCACCTGCAGGATGG + Intronic
976116870 4:81737220-81737242 ATGCAACTGAACAATCAGAACGG - Intronic
977207557 4:94180224-94180246 AAGCCACTCAAGAAGCAGGTGGG - Intergenic
977460377 4:97318076-97318098 AGGCAAGTCATCAAGCAGGATGG + Intronic
978285068 4:107067650-107067672 ATGCTACTCTCCAAGCACTAAGG - Intronic
978419336 4:108513320-108513342 ATGGTGCTGAACAAGCAGGGAGG - Intergenic
981895435 4:149793850-149793872 ATGCTACTGCTCAGGCAGGAGGG + Intergenic
984920746 4:184762272-184762294 ATACCACTCACCAAGGAGGAAGG + Intronic
988297331 5:29382582-29382604 ATGTTACTGAGCAAGGAGGATGG + Intergenic
988650856 5:33149034-33149056 ATCCTCCTCAAAAAGCAGTAAGG - Intergenic
989245190 5:39246334-39246356 ATGCTAACCAACAAACATGATGG + Intronic
989457094 5:41657042-41657064 AGGGTACTCAACATGAAGGAAGG - Intergenic
1005405775 6:25486300-25486322 ATGCTACTGAAACAGCATGAAGG - Intronic
1008377111 6:50804643-50804665 GTGGTACTCAACATGCAGGTGGG - Intergenic
1011394291 6:86890280-86890302 ATGCTGCTCTCTAAGCAGGAGGG + Intergenic
1011919816 6:92559529-92559551 ATGCAACTACACCAGCAGGAAGG + Intergenic
1012590914 6:100979488-100979510 GTGCAACTCAACAGGCATGAGGG - Intergenic
1015073484 6:129126245-129126267 AACCTACTCCACAAGCTGGAAGG - Intronic
1021931271 7:25583726-25583748 ATGATACTCACCAAACAGCATGG - Intergenic
1022771878 7:33482275-33482297 ATGGTAGTCAACCAGCAGGAAGG - Intronic
1026777144 7:73237608-73237630 CTGCAACTGAACAAGCAGAAGGG - Intergenic
1027017990 7:74790980-74791002 CTGCAACTGAACAAGCAGAAGGG - Intergenic
1027070034 7:75154947-75154969 CTGCAACTGAACAAGCAGAAGGG + Intergenic
1031583775 7:123508211-123508233 ATGCAACTCTAAAAGCTGGAAGG + Intronic
1032538698 7:132685674-132685696 AGGGGACTCAAGAAGCAGGAGGG - Intronic
1035279324 7:157767302-157767324 AAGCTTCTGAACAAGAAGGAGGG + Intronic
1035980140 8:4361225-4361247 AAGTTACTCAAAAAGCAGGAAGG + Intronic
1036916022 8:12804962-12804984 ATGCTTCTGAACAAGCAAGTAGG + Intergenic
1041681760 8:60600721-60600743 ATACTACTCAACAATAAGAAGGG + Intronic
1043738285 8:83774985-83775007 AGGCTGCACTACAAGCAGGAGGG - Intergenic
1044889279 8:96815436-96815458 ATACAACTTAACAAGCAGAATGG + Intronic
1046831826 8:118754684-118754706 ATCCTCCCCAACAATCAGGATGG - Intergenic
1049464893 8:142746637-142746659 ATGCTGCTCAACAGTCAGCATGG - Intergenic
1052046591 9:23800921-23800943 TTGCTTTCCAACAAGCAGGAAGG - Intronic
1058180507 9:101792372-101792394 CTGCTACATAACAAGCAGGACGG - Intergenic
1058189198 9:101892265-101892287 ATGCTTCCCAACCTGCAGGATGG + Intergenic
1059742260 9:117163406-117163428 ATACTACTCAACAAGTATAAAGG + Intronic
1060578194 9:124718117-124718139 ATGCTACTCAGCAAGAAAGCAGG + Intronic
1061506901 9:131036655-131036677 AGGCTACCCAACAAGCAAGGGGG + Intronic
1187757748 X:22545788-22545810 TGGCTCCCCAACAAGCAGGATGG - Intergenic
1187774983 X:22746286-22746308 AGGCTTCCCAACAAGCAGGCTGG - Intergenic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1189143317 X:38629422-38629444 GTGCTACTCAAAAAGCAACAAGG - Intronic
1191574885 X:62690252-62690274 ATACTACTCAATCAGAAGGATGG - Intergenic
1196670561 X:118362515-118362537 ATGCTCAGCAAAAAGCAGGAAGG - Intronic
1197250891 X:124215582-124215604 ATGATACTGAAGAAGCAGGCAGG - Intronic
1197384700 X:125788459-125788481 ATACTACTCCATTAGCAGGAAGG - Intergenic
1197837526 X:130711465-130711487 ATGCTATTAGACAAGCAGGATGG + Intronic
1200620152 Y:5434865-5434887 ATGCTTCTCAGCCTGCAGGATGG - Intronic