ID: 928626428

View in Genome Browser
Species Human (GRCh38)
Location 2:33144208-33144230
Sequence AGCATCAAGAAGGATATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928626426_928626428 -9 Left 928626426 2:33144194-33144216 CCTAACAGCACAATAGCATCAAG 0: 1
1: 0
2: 1
3: 11
4: 179
Right 928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 316
928626424_928626428 22 Left 928626424 2:33144163-33144185 CCCAGAGACAGTGGTTGCTTTAT 0: 1
1: 0
2: 0
3: 14
4: 205
Right 928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 316
928626425_928626428 21 Left 928626425 2:33144164-33144186 CCAGAGACAGTGGTTGCTTTATT 0: 1
1: 0
2: 0
3: 9
4: 159
Right 928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 316
928626423_928626428 23 Left 928626423 2:33144162-33144184 CCCCAGAGACAGTGGTTGCTTTA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928626428 Original CRISPR AGCATCAAGAAGGATATAGA AGG Intronic
903049976 1:20593469-20593491 TGCACCCAGAAGGATAAAGAAGG - Intronic
903836146 1:26204404-26204426 AGCATCCTGGAGGAGATAGATGG - Intergenic
907000003 1:50842769-50842791 AGCATGACTAAAGATATAGAGGG - Intronic
908430535 1:64052471-64052493 AACTTCAAGAAGAACATAGAAGG - Intronic
909203971 1:72729011-72729033 TGCAGCAACATGGATATAGATGG - Intergenic
909332100 1:74425796-74425818 AGAAGCAAGAAGGAGCTAGAGGG + Intronic
909409595 1:75334614-75334636 AGGAGCAAGAAGGGTATAAAGGG + Intronic
909539543 1:76775808-76775830 GGCATCAGGAAGGCTATATATGG + Intergenic
910022935 1:82614829-82614851 ATCATCAAGAAAGAAATACATGG + Intergenic
910610498 1:89136046-89136068 ATGATCAAAAAGGATAAAGATGG + Intronic
910630533 1:89348835-89348857 AGCATCCAGAAGAACATGGAAGG + Intergenic
910766435 1:90787267-90787289 AGAATAAAGATGGATATAGGTGG - Intergenic
911707251 1:101027605-101027627 AGAATCAAGATGGTGATAGACGG - Intergenic
912726679 1:112064686-112064708 AGCAGGAAGAAGGGGATAGAAGG + Intergenic
913085433 1:115432370-115432392 AGAAGCAAGAAGGATATAGCAGG - Intergenic
913492569 1:119395112-119395134 GACATCAAGAAGGTTAGAGATGG + Intergenic
916083056 1:161248283-161248305 AGCTTGAAGGAGGACATAGACGG - Intergenic
917158742 1:172033125-172033147 AGAAGCCAGAAGGACATAGATGG + Exonic
918335011 1:183500768-183500790 AGCATGAATAAGGATACTGAGGG + Intronic
919438349 1:197592547-197592569 AGGATCATGAAGGAACTAGACGG + Intronic
920009302 1:202856175-202856197 AACATCATTAAGGATGTAGATGG + Intergenic
921333670 1:214065062-214065084 AGGATGAAGAAGGAAATAGATGG - Intergenic
921728517 1:218551309-218551331 AGCATCAAGGATGAAATACATGG - Intergenic
922115590 1:222609796-222609818 ATAATCAGTAAGGATATAGAAGG - Intergenic
923843700 1:237704552-237704574 AGCAATAAGAAGGAATTAGAGGG - Intronic
923850925 1:237793693-237793715 AGCAGGAAGAAGCATCTAGAAGG - Intronic
924114064 1:240728390-240728412 AGCATGAAGAAGGAGACACAAGG + Intergenic
924187899 1:241515500-241515522 ACCACCAAGAAGGCTGTAGATGG + Intronic
1064517302 10:16165632-16165654 ATCATAAAGAAGGAAATAAAAGG + Intergenic
1065482352 10:26208649-26208671 AGCATCATGATGGGTATTGAAGG - Intronic
1065663596 10:28034161-28034183 AGTCTCAAAAAGGAAATAGAAGG - Intergenic
1069089597 10:64183683-64183705 AGCATTGAGAAAGATGTAGAAGG + Intergenic
1069608003 10:69752330-69752352 AGCAGAAAGAGGGAAATAGAAGG + Intergenic
1071065267 10:81626004-81626026 GAAATCAATAAGGATATAGAAGG - Intergenic
1071239545 10:83689858-83689880 AGTATCAAAAAGGATCTAGATGG + Intergenic
1071461028 10:85895856-85895878 AGCCACAAGGAGGATATAAAAGG + Intronic
1072158867 10:92747983-92748005 AGCATAGAGAAAGAAATAGATGG - Intergenic
1072850793 10:98889582-98889604 AGCAAGAAAAAGCATATAGAAGG + Intronic
1074785079 10:116832061-116832083 AGCAGCAAGAAAGACAAAGAAGG + Intergenic
1075421354 10:122302973-122302995 ACCATCAATAAGGAAAAAGAAGG - Intronic
1076308413 10:129482446-129482468 AAATTCAATAAGGATATAGAAGG - Intronic
1080657862 11:34271817-34271839 ACCATCAAGGAGCATATAGTTGG - Intronic
1080840578 11:35979926-35979948 ATCATCAAGAATGTTAGAGAAGG + Intronic
1080877019 11:36284481-36284503 ATATTCAACAAGGATATAGAAGG + Intronic
1081411354 11:42762208-42762230 AGAAACCAGAAGGCTATAGAGGG - Intergenic
1085548603 11:77345488-77345510 AGCAGCAAGAAGTATAAAGAAGG + Intronic
1085605787 11:77897374-77897396 AAAATAAAGAAGGATATACAAGG + Intronic
1085970690 11:81587340-81587362 AGCATCATGAAGAATACAGTTGG + Intergenic
1086820265 11:91427732-91427754 AGCATCAAGAAGAATAGCTAAGG - Intergenic
1087151363 11:94862511-94862533 ACCATCAAGATGCATAAAGATGG - Intronic
1088681316 11:112244898-112244920 CTCATCAAAATGGATATAGAAGG + Intronic
1088779316 11:113119103-113119125 AGGATAAAAAAGGATATAAAAGG + Intronic
1089111145 11:116057671-116057693 AATATCAGCAAGGATATAGATGG - Intergenic
1089723175 11:120449112-120449134 AGTATGAAGAAAGATAAAGAAGG + Exonic
1090324304 11:125871426-125871448 AGGAGCAAGAAGGATAAAGATGG - Intergenic
1090478237 11:127044157-127044179 AGCATCAAAAAGAATAATGATGG + Intergenic
1090866761 11:130707754-130707776 ACCATCTAGATGGATAAAGAAGG + Intronic
1092904112 12:13086680-13086702 AGAATAAAAATGGATATAGAAGG + Intronic
1093612995 12:21184996-21185018 ACCATCAAGAAGGACAAAGAAGG + Intronic
1093644000 12:21562196-21562218 AGCATGAAGGAGGAAAAAGAAGG - Intronic
1096311485 12:50525055-50525077 AGCATCAAGAGGGACAGAGAAGG + Intronic
1096390621 12:51226118-51226140 AGCATGAAGTAGGAAATAAATGG + Intergenic
1098092637 12:66920543-66920565 ACCATCAAGGAAGTTATAGAAGG + Intergenic
1098368175 12:69728246-69728268 AAAATTAAGTAGGATATAGAAGG - Intergenic
1098394115 12:70000435-70000457 ATCATGAAGAAGGAAAAAGAAGG - Intergenic
1098580299 12:72091596-72091618 TGCATCAAGAAGAATATTGTTGG + Intronic
1099114527 12:78608364-78608386 GGGATGAAGAAGGATAAAGAGGG + Intergenic
1099288383 12:80744289-80744311 AGCATCAAGCAGATTCTAGAGGG - Intergenic
1099570530 12:84311599-84311621 AGGATCCAAAAGGACATAGATGG + Intergenic
1099634998 12:85202539-85202561 AAGACCAAGAAGGATAAAGAAGG - Intronic
1100553576 12:95670805-95670827 TGGATCAAGAAGGATTTAAAAGG + Intronic
1101026358 12:100610603-100610625 AGTAACAGGAAGGATATACAAGG + Intronic
1102619667 12:114183955-114183977 AGGCTCAGGATGGATATAGAAGG - Intergenic
1104175464 12:126327712-126327734 AGCCCCAAGAAGGACCTAGAAGG - Intergenic
1105242023 13:18616826-18616848 AGCATCACCAGGGATAAAGAAGG - Intergenic
1105576214 13:21654786-21654808 AGAAACAAGAAGCATCTAGAGGG + Intergenic
1107196806 13:37662007-37662029 AGGATCAAGAAGGAGCTGGAAGG + Intronic
1107200006 13:37703535-37703557 AGCATCAAAAGATATATAGATGG + Intronic
1108551347 13:51548718-51548740 AGCTTCAAGCAGGGTATAGTTGG - Intergenic
1108711357 13:53035611-53035633 ACCATCAAGAAAGAGATGGAGGG - Intronic
1109191396 13:59328166-59328188 AGCATGAAGAAAGTAATAGATGG + Intergenic
1109876981 13:68417558-68417580 AACACTAAGAAGGATATGGAGGG - Intergenic
1110950891 13:81489359-81489381 AGCACCAATGAGGAGATAGAAGG + Intergenic
1111298667 13:86317689-86317711 ACCAGTAAGAGGGATATAGATGG - Intergenic
1112381896 13:98899254-98899276 AGCCACAGGAAGGATCTAGAAGG + Intronic
1112381898 13:98899264-98899286 AGGATCTAGAAGGATCCAGAAGG + Intronic
1112813142 13:103242423-103242445 AGTATCAAGCAGGATTTTGATGG + Intergenic
1113524797 13:110966412-110966434 GGGAGCAAGAAGGATAAAGATGG + Intergenic
1114065613 14:19057003-19057025 AGCATCAACAGGGATAAAGAAGG - Intergenic
1114096648 14:19342998-19343020 AGCATCAACAGGGATAAAGAAGG + Intergenic
1116090148 14:40294249-40294271 ATGATCAAAAAGGATAAAGAAGG - Intergenic
1116139405 14:40971390-40971412 AGCATCTAGAAGCAAAAAGATGG - Intergenic
1116637312 14:47413621-47413643 AGCATCAAGAGGGAGAGGGATGG - Intronic
1116977703 14:51133866-51133888 AAGATCAAAAAGGATAAAGAGGG + Intergenic
1117995636 14:61475194-61475216 AGCATCAAATAGGATATTTATGG - Intronic
1118445193 14:65844235-65844257 AGCATAAAGAAATATATTGAAGG + Intergenic
1118698031 14:68404263-68404285 ATCATCAAAAAGGAGAGAGAGGG + Intronic
1119135057 14:72210280-72210302 AGCAGCAAAAAGGAACTAGAGGG - Intronic
1119373403 14:74167378-74167400 AGCATCAAGGAAGATATAAGAGG + Intronic
1120351868 14:83371413-83371435 AGCATCATGAAGAAACTAGAAGG - Intergenic
1122120070 14:99548210-99548232 AACATCAATAAGGAAATACATGG + Intronic
1202937167 14_KI270725v1_random:100866-100888 AACATCAAAAAGGAGATAGTTGG - Intergenic
1123489348 15:20768320-20768342 AGCATCACCAGGGATAAAGAAGG + Intergenic
1123545847 15:21337407-21337429 AGCATCACCAGGGATAAAGAAGG + Intergenic
1123917420 15:25046810-25046832 AGCAAGCAGAAGAATATAGAAGG + Intergenic
1124601948 15:31140579-31140601 AGAAGCAAGAAGGATGGAGAAGG - Intronic
1125009329 15:34853588-34853610 AGCATGAAGAATGATCAAGAAGG - Exonic
1125846644 15:42860996-42861018 ACAATCAAGAAGGACAAAGAAGG + Intronic
1127969664 15:63948431-63948453 AGGAGCAAGAAGGAGAGAGAGGG + Intronic
1128327643 15:66735391-66735413 TGCATCATGAAGGATGTAGGGGG + Intronic
1130333448 15:82938993-82939015 AAAGTCAAGAAGGATAAAGATGG - Intronic
1130425181 15:83790349-83790371 AGTATTAAGAAAGATATAAAAGG + Intronic
1130870185 15:87965410-87965432 AGCATCATAAAGGAAAGAGAGGG - Intronic
1131561548 15:93447774-93447796 AGCATCAGGAAGAATAGCGAAGG - Intergenic
1131639891 15:94281318-94281340 ATAATCAAGAAGGACAAAGAAGG - Intronic
1134208134 16:12254047-12254069 AGCAGCCAGAAGGATGTGGAGGG + Intronic
1134227856 16:12405501-12405523 AGCATCAGGAAGGCTGCAGAAGG - Intronic
1134559904 16:15199594-15199616 AGCATCAAGAAGAATAGCTAAGG + Intergenic
1134920444 16:18111204-18111226 AGCATCAAGAAGAATAGCTAAGG + Intergenic
1136638612 16:31542558-31542580 AGAATAAAAAAGGATCTAGAAGG + Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1139468015 16:67164487-67164509 AGAACAAAGAAGGAAATAGAGGG + Exonic
1141210078 16:81970953-81970975 AGGATCAATAAGGAAACAGAGGG - Intergenic
1143660693 17:8322793-8322815 TGCAGCAAGAAGGATAAAAAGGG + Intergenic
1143932799 17:10447912-10447934 AGGATCAAGAAGAAGATGGAGGG - Exonic
1145709396 17:26956061-26956083 AGCATCAAAAAGGAGGTAGTTGG + Intergenic
1148506261 17:48129681-48129703 ACCATCAAGAAAGATATAGTTGG + Intergenic
1154446927 18:14443052-14443074 AGCATCACCAGGGATAAAGAAGG + Intergenic
1155540499 18:26863884-26863906 GACAGCAAGAGGGATATAGACGG - Intronic
1156432288 18:37088962-37088984 AGCATAAAGAAAGGTTTAGAAGG - Intronic
1156976127 18:43223479-43223501 AGCAGGAATAGGGATATAGAAGG + Intergenic
1157282060 18:46352647-46352669 AGCATCAAGATGGAGGAAGAAGG + Intronic
1158098270 18:53800110-53800132 AGGATATAGAAGGATATGGAAGG - Intergenic
1158951167 18:62496668-62496690 AGAAACAAGTAGGATATAAATGG - Intergenic
1159302099 18:66587083-66587105 ACCTTCAAGAAGGCAATAGAAGG - Intronic
1162455677 19:10782980-10783002 CGCAGCCAGAAGGATATTGAGGG + Exonic
1162581732 19:11535564-11535586 AGCATCAGGAAGGTTTTAGGGGG + Intergenic
1163540220 19:17904437-17904459 AGAATCAAAAAGGATATGTAGGG + Intergenic
1167771661 19:51524504-51524526 AGAATCACTAAGGATATAGAAGG + Intronic
925506607 2:4572648-4572670 AGTTTCAAGAAGGAAATAGGAGG - Intergenic
925508891 2:4602673-4602695 AGCATCAGGAAGGATAGCTAAGG - Intergenic
925514283 2:4663191-4663213 TGCATCATGAAGGATTTAGTAGG + Intergenic
925675621 2:6358306-6358328 AGCATCAAGAAGGAAGCCGAAGG + Intergenic
927223440 2:20737235-20737257 AACATCAAGAAGACTATACAAGG - Intronic
927371073 2:22355855-22355877 AGCATCAGGAACCATCTAGAGGG - Intergenic
928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG + Intronic
929078823 2:38101747-38101769 AGCATAAAGAAAGACATGGAAGG + Intronic
929279389 2:40061507-40061529 TGCATCTAGAAGGGTCTAGAAGG - Intergenic
931533394 2:63243592-63243614 AGCATCAAAAAGGACAAAGAAGG + Intronic
934997021 2:98973270-98973292 GGCATCAAGAAAGATTTTGAAGG - Intergenic
935924648 2:108053910-108053932 AGCTTCAGGAAGGAAATTGAAGG - Intergenic
936095028 2:109524872-109524894 AGAATCAAGAAGGAAACAAATGG + Intergenic
937022306 2:118668716-118668738 AGCATCAAGCAGGTTACAGCAGG + Intergenic
938483029 2:131677367-131677389 AGCATCAACAGGGATAAAGAAGG - Intergenic
938968863 2:136413545-136413567 AGCATAAAGAATTATATAGTAGG - Intergenic
939445626 2:142306628-142306650 AGCAACAAGAAAGTTATACAAGG + Intergenic
939840845 2:147184768-147184790 AACATCAAAAAAGATAAAGAAGG + Intergenic
940083668 2:149833501-149833523 AGCATAAAGAAGCACAAAGAGGG - Intergenic
940275122 2:151932018-151932040 AGCATGAAGAAACATACAGAAGG + Intronic
941594138 2:167454909-167454931 AGGATCCAGAAGTATATACAGGG + Intergenic
943856598 2:192801999-192802021 AGCATCATGCATGAAATAGAGGG + Intergenic
944167675 2:196740639-196740661 AACATCAAAAAAGATAAAGAGGG - Intronic
944660903 2:201920771-201920793 AGAAACAAGAAGAAGATAGAGGG - Intergenic
947085938 2:226453205-226453227 AGCATAAAGAAGAATAAAGCTGG + Intergenic
948254221 2:236554241-236554263 AGCATCACTAAGGATCCAGAGGG + Intergenic
948268209 2:236654141-236654163 AGGATCAAGATGGATCCAGAGGG - Intergenic
948968842 2:241407594-241407616 AGCTACAAGAAGAATATACAAGG + Exonic
1169254141 20:4084384-4084406 AGGATCAAGAGGCATTTAGAAGG + Intergenic
1169819422 20:9692270-9692292 AGCAATAAGAAGGTTAAAGATGG + Intronic
1169856323 20:10107526-10107548 AACACCAAGAAAGACATAGATGG + Intergenic
1170157557 20:13282483-13282505 AGCCTCAAGATGGAAATAGAGGG - Intronic
1171043119 20:21785088-21785110 ATCATTAAGAGGGATAGAGAGGG - Intergenic
1173881866 20:46420610-46420632 AGCATGAAGAAAGATATAGATGG - Intronic
1174530472 20:51208804-51208826 AGCCTCAACAAGGGTGTAGAGGG + Intergenic
1176449044 21:6846783-6846805 AGCATCACCAGGGATAAAGAAGG - Intergenic
1176827213 21:13711806-13711828 AGCATCACCAGGGATAAAGAAGG - Intergenic
1177222654 21:18214945-18214967 AGCATCCAAAAGGATAAAAATGG + Intronic
1179069562 21:38059026-38059048 AGAATCAAGGAGGAGCTAGAAGG - Intronic
1179357963 21:40679193-40679215 AGCATTAAGAAGAATTTAAAAGG + Intronic
1179944516 21:44662570-44662592 AAAATCAGGAAGGATACAGAAGG + Intronic
1180484094 22:15779596-15779618 AGCATCAACAGGGATAAAGAAGG - Intergenic
1180691016 22:17715704-17715726 AGTAACAAGAAGGATTCAGATGG + Intronic
1181538039 22:23556879-23556901 AGCATCTAGAAGGCTCTAGAAGG + Intergenic
1182200131 22:28560171-28560193 AGCATCAAGTAGGATTTGGAGGG - Intronic
1182514334 22:30844964-30844986 AGGCTCAAGAAGGAGAGAGATGG + Intronic
1183135549 22:35883657-35883679 AGCAGCAAGAAGGAACCAGAGGG + Intronic
1183552897 22:38502478-38502500 GGGAACAAGAAGGAGATAGAAGG - Intronic
1184073792 22:42163342-42163364 AGGAACACGAAGGCTATAGAGGG - Intronic
1184110915 22:42394336-42394358 AGGATCAATAAGGACATGGAGGG - Intronic
1184395692 22:44237067-44237089 AGCAACAGGAAGGATATATCTGG - Intergenic
950829054 3:15856762-15856784 AGCATCAGGAGGGTTCTAGATGG - Intronic
951149773 3:19275103-19275125 AGCATGAAGAAATATATAGTAGG - Intronic
952144027 3:30512085-30512107 AGGAGCAAGAAGGAGAGAGAGGG - Intergenic
954177203 3:48853923-48853945 GGCATCAAGAAGCATATAACTGG - Intergenic
954958333 3:54541701-54541723 AGCATCAAGAAAGATCATGAAGG + Intronic
955116321 3:56008145-56008167 ATGATCAAGAAGGAAATACATGG - Intronic
955904933 3:63796824-63796846 TGCATAAAGAAGGATATAGAAGG - Intergenic
956457165 3:69433622-69433644 GGCATCAGGAAGGAGAGAGAGGG - Intronic
957015030 3:75053317-75053339 AGCATCATGAAGTAAATAAATGG + Intergenic
959825504 3:110791014-110791036 AGCATGAAGAATGGTATGGAAGG + Intergenic
962546881 3:136445741-136445763 AGCATTAAGAGGGATAGAAAGGG - Intronic
963713641 3:148777234-148777256 AGCATTAATAAGGACAAAGATGG + Intergenic
964575679 3:158164969-158164991 AACTTCAAGAAGGCTATATAGGG - Intronic
964831498 3:160888414-160888436 AAGATCAAAAAGGATAAAGAAGG + Intronic
965201220 3:165660178-165660200 AGCGTGAAGAGGGATAAAGAAGG - Intergenic
966014291 3:175122192-175122214 TGCCTCAGGAAGGAAATAGAGGG + Intronic
966904498 3:184512348-184512370 AGCATGAAGAAGTTTTTAGAGGG + Intronic
968329489 3:197853890-197853912 ATCATCAAGAAGGAAATATTGGG - Intronic
968829572 4:2925985-2926007 AGAAGCAAGAAGGATATGGTAGG - Intronic
970181546 4:13402271-13402293 AGAATCAGTAGGGATATAGAAGG - Intronic
970660730 4:18282481-18282503 AAAATCAAGAGGCATATAGAAGG - Intergenic
972069069 4:34992216-34992238 AGCTTCAAGAGAGATATTGAAGG - Intergenic
972380185 4:38512250-38512272 GGCATAAAGAAGGATGAAGATGG + Intergenic
973009860 4:45058972-45058994 AAAATCAGTAAGGATATAGAAGG + Intergenic
974329995 4:60465728-60465750 AAAATGAAGAAGGATATTGAAGG + Intergenic
974908495 4:68085754-68085776 AGCAGCAAGAACGGTAAAGAAGG + Intronic
975021733 4:69499620-69499642 AAGATCAAGAAAGATAAAGAAGG - Intronic
975101192 4:70514905-70514927 AGCATAAAGAAGGATCTTTAAGG + Intergenic
976235950 4:82897236-82897258 AGCATCAAGCCTGATATGGAGGG - Intronic
978057882 4:104295370-104295392 AGCATCTAGAAGCATATAATAGG - Intergenic
979021597 4:115506600-115506622 AAAATCAGGAATGATATAGATGG + Intergenic
979368514 4:119854596-119854618 AGCTTCAAGAAAAAAATAGAAGG - Intergenic
979893916 4:126134284-126134306 AGAATAAAGAAGCATCTAGAAGG + Intergenic
980173211 4:129314025-129314047 AGAATGAAGAAGGGTAGAGAAGG - Intergenic
980255844 4:130380297-130380319 AGCATTTAAAAGGATATATATGG - Intergenic
980924856 4:139125879-139125901 AGCATCATGAAGGAGAGAGAAGG - Intronic
980963399 4:139498502-139498524 AGGATCAAGTAGGAGGTAGATGG - Intronic
981448699 4:144870739-144870761 AGCATGAAGATGAATATAAAGGG - Intergenic
981591261 4:146364962-146364984 AGCATTAAAAAGGAAATGGAAGG - Intronic
982343012 4:154324203-154324225 AGCATCAATAAGGATAAAAATGG - Intronic
982821241 4:159942657-159942679 AGCATCCAGAAGGCTATGAAAGG + Intergenic
982853605 4:160352173-160352195 TGCATCAAGAAGAATAGAAAAGG + Intergenic
982899513 4:160980762-160980784 AGCAACAAGAAGGCTCTAGGGGG - Intergenic
983118903 4:163855815-163855837 AGCATCAAAAAGAATCTAAATGG - Intronic
983182108 4:164660164-164660186 GTCATTAAGAATGATATAGATGG + Intergenic
986149865 5:5118403-5118425 ACAATCAGGAAGGATAAAGAAGG - Intergenic
986843805 5:11729382-11729404 AGCATCTAGAAAAGTATAGAAGG - Intronic
989019532 5:36986058-36986080 AAAATCAAGAGGGATAAAGATGG + Exonic
989276555 5:39596915-39596937 AACATCAAAAAGGACAAAGAAGG - Intergenic
990241550 5:53821137-53821159 AGCATCCAGAAGTTTCTAGAGGG - Intergenic
990547913 5:56841948-56841970 AGCATACAGAAAGATACAGATGG + Intronic
990623441 5:57585275-57585297 AGCTTCAAGTAGTATATAGTTGG + Intergenic
991477114 5:67034321-67034343 AGGCTCAAGAAGGAAATGGACGG + Intronic
992210435 5:74474411-74474433 AGCATGGAGAAGGATGTATACGG + Intergenic
992941152 5:81763333-81763355 AGCATCAAGCAAGCTATAGGTGG - Intergenic
994031361 5:95147456-95147478 ACTATCAAGAAGGACAAAGAAGG - Intronic
994312595 5:98292324-98292346 AGCTTGAAGAAGGGAATAGAGGG + Intergenic
996141958 5:119922352-119922374 ATAATCAAAAAGGATAAAGAAGG - Intergenic
996785408 5:127231563-127231585 ATTATCAAGAAGATTATAGATGG - Intergenic
997021701 5:130009871-130009893 ACCATCAAGAAGCACAAAGAGGG + Intronic
997378438 5:133416180-133416202 TGCATCAAAAAGGACATAAAAGG + Intronic
997632444 5:135379076-135379098 AGCATCAATCAGAATATCGATGG + Intronic
998636125 5:143956633-143956655 AAAATCAAGAAGGCTAAAGAAGG + Intergenic
999019255 5:148145063-148145085 AGCCTCTACAAGGATAGAGAAGG + Intergenic
999697334 5:154198689-154198711 TGAATCTAGAAGGATACAGAGGG - Intronic
999906424 5:156145515-156145537 AGATTCAAAAAGGATATAGAGGG - Intronic
1002566529 5:180115321-180115343 AGCATCAAGAAAGACAGAGGGGG - Intronic
1002998554 6:2309751-2309773 ACCAGCAAGAAGGATAAAGAAGG - Intergenic
1003195737 6:3912602-3912624 GGCATCATGAAGGATATACAGGG + Intergenic
1003717415 6:8663437-8663459 AGCTTCCAGAAGGATAAAAAAGG - Intergenic
1003883772 6:10502313-10502335 AAAACCACGAAGGATATAGAAGG - Intronic
1003940120 6:11016141-11016163 AGAAGGAAGAAGGAAATAGAGGG - Intronic
1003992776 6:11503194-11503216 AAAATCAGTAAGGATATAGAAGG - Intergenic
1007916970 6:45570043-45570065 AGCATCAAGAAGTCTAGTGATGG - Intronic
1008183089 6:48357512-48357534 AGGATCAAAAAAGATAAAGAAGG + Intergenic
1009983929 6:70759529-70759551 ATTATCATGAAGGATATTGAGGG + Intronic
1010037022 6:71337654-71337676 AGCATCAAGAAGAATAGCTAAGG + Intergenic
1010109470 6:72208749-72208771 AACATCAAGAAAGATATAAAAGG - Intronic
1010457791 6:76078751-76078773 AGCATAATGAAGGATAGAGTTGG + Intergenic
1012311974 6:97736796-97736818 AACATCAAAAAGGACAAAGAAGG - Intergenic
1012415192 6:99005472-99005494 AGCATGAAGAAGGGATTAGAGGG - Intergenic
1012564739 6:100634253-100634275 AGCTAGAAGAAGGATATTGAAGG - Intronic
1013173583 6:107658833-107658855 GGCATCAAAAAGGATAAAGGTGG - Exonic
1013598889 6:111685711-111685733 ATCATCAAGAAGGAAGCAGATGG - Intronic
1014607898 6:123500643-123500665 AGAATCAAGAAGGAGAGAAATGG - Intronic
1016631711 6:146240660-146240682 AGGATGAAGAAGGATGGAGAAGG + Intronic
1018569174 6:165188734-165188756 AGCATTAAGAAGGATAAGGAAGG - Intergenic
1020382173 7:7558385-7558407 AGGATCAAAAAAGATAAAGAAGG + Intergenic
1020698756 7:11449879-11449901 AGCCTCAAGAATGATATATTTGG + Intronic
1020961135 7:14803332-14803354 AGCATCACTAAGGAAAAAGAGGG - Intronic
1022353903 7:29592899-29592921 AGCATGAAGAAACATCTAGAAGG - Intergenic
1023903341 7:44502194-44502216 ATCTCCAAGAAGGATTTAGATGG - Intergenic
1025234703 7:57226816-57226838 AGCACCAAGAAGGAAATGAAGGG + Intergenic
1025763718 7:64420713-64420735 AGTAACAAAAAGGATAAAGAAGG + Intergenic
1027850851 7:83450012-83450034 AGCCTCAATAAGCATATAAAAGG + Intronic
1027930569 7:84528832-84528854 GGAATCAAGAAGGATATCAAAGG - Intergenic
1028295875 7:89130577-89130599 AGCATCATGAAGGATAAAAGGGG + Intronic
1029470889 7:100753318-100753340 AGCATCTAGAAGCAACTAGAAGG - Intronic
1032415304 7:131730988-131731010 AGAATCAAGGTGGATATGGAGGG - Intergenic
1033289256 7:140068684-140068706 AATATCAGCAAGGATATAGAAGG + Intergenic
1034747911 7:153539828-153539850 TTCATCAAGAAGGCTTTAGAAGG - Intergenic
1036105109 8:5830060-5830082 GGGAGCAAGAAGGATAAAGATGG - Intergenic
1038224595 8:25644236-25644258 AGCGTCAAGAAAGACAGAGAGGG - Intergenic
1038262269 8:26006570-26006592 CTCATCAGGAAGAATATAGAAGG - Intronic
1039700027 8:39952702-39952724 GGCATCAAGAAGGTTACAGCAGG + Intronic
1041268335 8:56086106-56086128 AGCAGGAAGGAGGATAGAGAAGG - Intergenic
1041962645 8:63636572-63636594 AGCATCTAGAAGGGCATGGAAGG + Intergenic
1043225878 8:77729443-77729465 ACCTTAAAGAAGGATAAAGAAGG + Intergenic
1043320282 8:78975863-78975885 AGCATCAAGAAGGAACAAGAAGG - Intergenic
1043822843 8:84889845-84889867 AGCATTAACAAGGATAAAGGTGG - Intronic
1044049948 8:87488526-87488548 AGCATAAATAATGATAGAGATGG + Intronic
1044343779 8:91078985-91079007 AGCTTCAGGAAGTATATATAGGG + Intronic
1044918335 8:97140043-97140065 AACATCAAGAATGAAAAAGAGGG + Intronic
1045139521 8:99265398-99265420 AACCTCAAGAAGGAAATGGACGG - Intronic
1045480538 8:102588080-102588102 AGCATGAACAAAGACATAGAGGG + Intergenic
1046318015 8:112532185-112532207 AGGATTAAGAAGAATAAAGAAGG + Intronic
1047795494 8:128251046-128251068 ATCATCAAGAAAAAAATAGAAGG + Intergenic
1047980575 8:130176988-130177010 AGCATCAAGAGGAAGAGAGACGG - Intronic
1048041674 8:130735540-130735562 ACAATCAAGAAGGACAAAGAAGG + Intergenic
1048140980 8:131793973-131793995 AGCTTCAAGAAGGAGATGGGAGG + Intergenic
1049133886 8:140875986-140876008 AGCATCATTAGGGATATAGAAGG - Intronic
1050280009 9:4040574-4040596 TCAATCAATAAGGATATAGAAGG + Intronic
1050340771 9:4636238-4636260 AGCATAATGAAGCATTTAGATGG - Intronic
1050595491 9:7200463-7200485 AGCAAAAAGAAGGAAAAAGATGG + Intergenic
1051022658 9:12563503-12563525 AGCATCAAGAAGCCAAAAGAAGG - Intergenic
1051749143 9:20323394-20323416 GGCATCAAGGAGGAAATACAGGG - Intergenic
1052427193 9:28320817-28320839 AACGTCAAGAAGGAAACAGAAGG - Intronic
1052828839 9:33198297-33198319 AGCCTCAAGAGTGATATAAAAGG + Intergenic
1053161730 9:35818227-35818249 AGTTTCAAGAAGGATAGAGTGGG - Exonic
1053331500 9:37212823-37212845 AGCATGGAGAAAGATATAGAAGG - Intronic
1055005973 9:71507295-71507317 AACATCCAGAAGGAAATATATGG + Intergenic
1055324492 9:75114878-75114900 AGCATGAAGAAAGGAATAGATGG - Intronic
1056710039 9:88984895-88984917 AGCATCAAGACTGCTAAAGATGG + Intergenic
1057375999 9:94523722-94523744 AGCAGTAAGAAGGATATAACAGG - Intergenic
1059090055 9:111346913-111346935 AAGATCAACAAGGATGTAGAAGG + Intergenic
1060253810 9:122007552-122007574 AGCATCAAAATAGATATTGATGG + Intronic
1061243949 9:129391684-129391706 AGCATCTAGAAGGCTCTAGAAGG - Intergenic
1061564679 9:131430464-131430486 AGCTTCAATAAGGTAATAGATGG - Intronic
1186744083 X:12548040-12548062 AGAATTAACAAGGATATATATGG - Intronic
1186885180 X:13905894-13905916 AGCATCAAGATGGATTCAGAGGG - Intronic
1187025811 X:15434285-15434307 AGAAAGAAGAAGGAGATAGAAGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187362347 X:18640580-18640602 AGCATCAAGAAGGATGTTTGGGG + Exonic
1188979350 X:36713181-36713203 AGCATAATGGAGGACATAGAGGG + Intergenic
1190992766 X:55568909-55568931 AACATCAAAAAGGACAAAGAAGG + Intergenic
1191137866 X:57085110-57085132 ATGATCAAGAAGGATAAAGAAGG + Intergenic
1191915969 X:66201441-66201463 AGGAAGAAAAAGGATATAGAGGG - Intronic
1192002944 X:67175507-67175529 AGGATCAAGAAAGACAAAGAAGG - Intergenic
1193432679 X:81429467-81429489 AGTTTTAATAAGGATATAGAAGG - Intergenic
1194001094 X:88429429-88429451 AGCATCAATGAGGATATTGATGG - Intergenic
1194218898 X:91167489-91167511 AGCATCAAGTGGGCTATTGAGGG - Intergenic
1194804476 X:98310412-98310434 ACCATTAAGAAGGAGAGAGAAGG + Intergenic
1195033625 X:100950486-100950508 AAAATCAAAAAGGATATAGAAGG + Intergenic
1196472160 X:116040630-116040652 AGAATGAAAAAGGATCTAGAAGG + Intergenic
1196716717 X:118818881-118818903 AGCATTACGAGAGATATAGAAGG - Intergenic
1197366430 X:125569088-125569110 AAGATCAAGAAAGATAAAGAAGG + Intergenic
1197446691 X:126559022-126559044 GGCATCAGGAATGAAATAGAAGG + Intergenic
1197546286 X:127828925-127828947 TATATCAAGAAGGAAATAGAAGG - Intergenic
1197654452 X:129101481-129101503 ACCAACAAGAAGAAAATAGATGG + Intergenic
1198065683 X:133094318-133094340 AAGATCCAGAAGGATCTAGAAGG + Intronic
1198650260 X:138855285-138855307 AGGATCCAGAAGGCTTTAGATGG - Intronic