ID: 928631870

View in Genome Browser
Species Human (GRCh38)
Location 2:33201815-33201837
Sequence ATAAGCCTTAGGGCAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928631866_928631870 2 Left 928631866 2:33201790-33201812 CCTTTAATTATTGGTCATATAAA 0: 1
1: 1
2: 1
3: 28
4: 337
Right 928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG 0: 1
1: 0
2: 1
3: 12
4: 139
928631864_928631870 30 Left 928631864 2:33201762-33201784 CCTGAAATCATTGTGAAAACTCT 0: 1
1: 0
2: 2
3: 25
4: 258
Right 928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928631870 Original CRISPR ATAAGCCTTAGGGCAAAATT GGG Intronic
904514980 1:31047519-31047541 CTAAGCCTGAGTACAAAATTAGG - Intronic
904978351 1:34476032-34476054 ACAAGCCCTGGGGCAAAATTAGG + Intergenic
906806287 1:48781908-48781930 ATAAGCTTTAGAGAAAAAATAGG - Intronic
909302808 1:74035586-74035608 ATAATTCTTAGGGCACACTTTGG - Intronic
911330180 1:96517862-96517884 TTAAGCATTAGGGCACAGTTTGG + Intergenic
911750060 1:101486350-101486372 ATAATCCTCAAAGCAAAATTAGG - Intergenic
912849768 1:113112946-113112968 AAAATACATAGGGCAAAATTAGG + Intronic
922350624 1:224732232-224732254 ATAAGCCTTGGCCCATAATTGGG + Intronic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
924953151 1:248904184-248904206 ATAAGCTTTAAGGAAAAAATTGG - Intergenic
1063077122 10:2728744-2728766 TTAAGCCTGAGGGCAAAAAAAGG + Intergenic
1063793974 10:9489235-9489257 ATAAGTCTTAGCCCAAAGTTAGG - Intergenic
1065083888 10:22154921-22154943 GAAAGTCTTAGGGAAAAATTTGG + Intergenic
1066511570 10:36104149-36104171 TTTAGCCTTACAGCAAAATTGGG - Intergenic
1066680826 10:37935908-37935930 ATAAGCCTTAGGGCAGCATGGGG + Intergenic
1067194071 10:44099165-44099187 AAAATACATAGGGCAAAATTTGG + Intergenic
1073388269 10:103147355-103147377 CAAAGCCTTAGGGCATATTTAGG - Intronic
1073663196 10:105500451-105500473 ACAAGCCTTAAGGAAAAATTTGG - Intergenic
1073711215 10:106044851-106044873 ATAAGCATTAAAGCAAAATCTGG - Intergenic
1074142664 10:110688446-110688468 GAAATCCTTAGGGCCAAATTTGG - Intronic
1081300438 11:41444683-41444705 ATAAGCTTGAGTACAAAATTGGG + Intronic
1081351919 11:42064552-42064574 ATTATCTTTAAGGCAAAATTAGG - Intergenic
1085145880 11:74196824-74196846 ATAAACTTTAAAGCAAAATTAGG + Intronic
1087774548 11:102245328-102245350 ATAATCCTTAGGTCAAAGGTTGG + Intergenic
1089237534 11:117044680-117044702 ATCAGCCTTTGGGCAACATAGGG + Intronic
1090411885 11:126514948-126514970 ACAAGGCTTAGGGAAAATTTAGG - Intronic
1091207010 11:133828688-133828710 AGATGCTTTAGGGCAAGATTTGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092913740 12:13171341-13171363 ATCATCCTTATGGCAAAATGTGG + Intergenic
1094091699 12:26657112-26657134 AGAAGCCTTGGGGCCAAGTTGGG - Intronic
1099496591 12:83354407-83354429 GTAAGTTTTAGGACAAAATTTGG + Intergenic
1099551364 12:84047898-84047920 CTAAGCCTTAGCTCAAAATGGGG - Intergenic
1099719960 12:86347941-86347963 ATAAGCCTAAAGAAAAAATTAGG - Intronic
1100079814 12:90834906-90834928 ATAAGCCTTATCTGAAAATTTGG + Intergenic
1101835151 12:108289792-108289814 ATAAGCATTAAGGCACAATAAGG + Exonic
1102630356 12:114273047-114273069 ATGAGCCATGGGGGAAAATTGGG + Intergenic
1112020291 13:95365659-95365681 TTTTGCCTTAGAGCAAAATTGGG - Intergenic
1112417108 13:99212382-99212404 GAAAGCCTTAGGGAAAAATCTGG - Intronic
1113401076 13:109993896-109993918 ATCAGACTTAGGGGAAAAATAGG + Intergenic
1114176178 14:20322391-20322413 CCAAGCCTTAGGGCAAAAGAAGG + Intronic
1115802160 14:37007253-37007275 AAAAGCCTTAGGTAAAAATTAGG + Intronic
1115927124 14:38448388-38448410 ATTATCTTTAGAGCAAAATTAGG - Intergenic
1116894679 14:50304459-50304481 ATAAACCTTGGGGCAATAATTGG + Intronic
1116975121 14:51107293-51107315 ATAAGTGTTAGTGAAAAATTAGG - Intergenic
1119048573 14:71343515-71343537 ATAAGACTTCGTGGAAAATTTGG + Intronic
1125952364 15:43763571-43763593 ATAAACCCTTGGGAAAAATTAGG - Intronic
1130354403 15:83116791-83116813 ATAAGACTTGGGGACAAATTGGG + Intronic
1131300365 15:91194368-91194390 TTATGCCTTTGGGCATAATTGGG + Intronic
1132070154 15:98769323-98769345 ATACCCCTTAGAGCAAAAATAGG - Intronic
1135610565 16:23862950-23862972 ATTATCCTTAAAGCAAAATTAGG - Intronic
1136111819 16:28068158-28068180 ATAAGCTTAAGGGCCAGATTTGG - Intergenic
1137006173 16:35275969-35275991 ATAAGGCTTAGGGCAGCATCGGG - Intergenic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1150523322 17:65892585-65892607 TTCAGACTTGGGGCAAAATTTGG - Intronic
1151457968 17:74237948-74237970 ATAAGCCATTGGCCAAAATCAGG + Intronic
1153829460 18:8908974-8908996 ATATGCCTATGAGCAAAATTTGG + Intergenic
1155439145 18:25843023-25843045 CCAAGCCTTAGGGCAAAGCTGGG + Intergenic
1158746829 18:60209738-60209760 CTAAGCTTTATGGCAGAATTGGG - Intergenic
1159326021 18:66918693-66918715 ATAATCCTTAATGCAAAACTAGG - Intergenic
1159593115 18:70356482-70356504 GGAAGCCTTAGGCCAATATTTGG + Intergenic
1159839506 18:73381956-73381978 ATAAGTTATATGGCAAAATTGGG + Intergenic
1165272495 19:34723123-34723145 ATAAGGCTTAGGGCAGCATCAGG + Intergenic
1168531512 19:57133487-57133509 ATAAGGAATGGGGCAAAATTAGG + Intergenic
927376946 2:22428749-22428771 AATAGCCTTAGAACAAAATTTGG - Intergenic
928083891 2:28333656-28333678 ATATGCCTGAGGGCAAAATGAGG - Intronic
928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG + Intronic
932805865 2:74782895-74782917 ACAATCCTTAGGGGAAAAATGGG + Intergenic
934570183 2:95365610-95365632 AAAAGGCTTAGGGGAAAATATGG + Intronic
936431295 2:112465945-112465967 ATGAGCATTAGGGAAAAACTAGG + Intergenic
936760854 2:115780137-115780159 ATAAGTCTGAATGCAAAATTTGG - Intronic
937782840 2:125859014-125859036 ATAAGGCTTAGGGCATAATTAGG + Intergenic
941253095 2:163191679-163191701 AAAAACCTAAAGGCAAAATTAGG - Intergenic
942243251 2:173983426-173983448 ATAACTCTTAGGGCCAATTTTGG - Intergenic
944565749 2:200989397-200989419 ATAACTCTTAGGGTAAGATTAGG + Intronic
947345029 2:229181588-229181610 AAAAGCCTTAGAGGAATATTTGG - Intronic
947396034 2:229687784-229687806 ATTAGCCTTATGTCTAAATTTGG - Intronic
1172824311 20:37767564-37767586 AAAAGCCTTAGGGAAAACTCAGG - Intronic
1178003043 21:28185225-28185247 ATATGCTTTAGAGAAAAATTTGG + Intergenic
1178221513 21:30665883-30665905 GGAATCCTTATGGCAAAATTGGG - Intergenic
949168995 3:976245-976267 TTCAGCCCTAGGGCCAAATTTGG - Intergenic
952563633 3:34627933-34627955 AAAAGCCCTAGGGCAAAGATAGG - Intergenic
952631344 3:35471955-35471977 AGAAGAATGAGGGCAAAATTTGG - Intergenic
953039980 3:39247597-39247619 AAAAGCTATAGGGGAAAATTTGG + Intergenic
953832695 3:46314839-46314861 AAAATCCTTAGGACAAAAATGGG - Intergenic
955554461 3:60120919-60120941 ATAAACCTAAAGGCAAAATTTGG - Intronic
956034873 3:65079857-65079879 ACAGGACTTAGGGCAAAATGGGG + Intergenic
956556074 3:70524455-70524477 AGAAGCCTTGGGCCAAATTTTGG + Intergenic
956682762 3:71796829-71796851 ATAAGCATTTGAGCAAATTTTGG + Intergenic
958449230 3:94252615-94252637 ATAGGACTTAAGGCAAGATTGGG + Intergenic
959230664 3:103646932-103646954 AAAAGACTGAGGGCAAAATTAGG + Intergenic
959454779 3:106545900-106545922 ATATGCCTATGAGCAAAATTTGG + Intergenic
959794802 3:110413004-110413026 GAAAGTCTTAGGGCAAAACTTGG + Intergenic
960168203 3:114428086-114428108 ATAATCCAAAGGGCACAATTTGG + Intronic
962541992 3:136391673-136391695 ATAAGAGTTAGGGCTAAAATGGG - Intronic
964756317 3:160093222-160093244 ATTAGCCTTAGGTCATCATTTGG + Intergenic
965841319 3:172908971-172908993 AAAAGCCCTTGGGAAAAATTTGG + Intronic
965923999 3:173955238-173955260 ATAAGTCAATGGGCAAAATTTGG + Intronic
973878654 4:55246956-55246978 ATAAGCCTTGGGGATAAATGGGG - Intergenic
974611439 4:64223427-64223449 CTAAGCCTGAGGGGAAAAGTAGG + Intergenic
974974093 4:68868141-68868163 ACAAACCTTAGGCCAAATTTTGG - Intergenic
974981082 4:68957925-68957947 ATAAACCTTATGCCAAATTTTGG - Intergenic
976646277 4:87390610-87390632 GTTATCCTTAGGGCAAAAATGGG + Intronic
980875900 4:138661809-138661831 ATTATCCTTAAAGCAAAATTAGG + Intergenic
983365372 4:166780414-166780436 AGAAGACTTAGGGCAAGATAAGG + Intronic
988238656 5:28579025-28579047 ATCAGCTTTATGCCAAAATTTGG + Intergenic
989743058 5:44794396-44794418 ATTATCCTTAAAGCAAAATTAGG + Intergenic
990808760 5:59698125-59698147 AGAAGACTTCAGGCAAAATTAGG - Intronic
995059380 5:107796949-107796971 CTAAGCCTTAAGGCAAAAACTGG + Intergenic
995626185 5:114078687-114078709 ATAAGGCTTAGAGGAATATTTGG + Intergenic
995717714 5:115096667-115096689 TTATGCCTTAGGGCCAAAGTGGG - Intergenic
999090635 5:148933010-148933032 ATAAGTATTAGGCCAAAATATGG - Intronic
1000744216 5:165011347-165011369 ATTAGCCATAGGGTAATATTTGG - Intergenic
1000786169 5:165546620-165546642 ATAATTTTCAGGGCAAAATTTGG + Intergenic
1001321385 5:170685133-170685155 AAAAGTCTTAGGGCCAAATTGGG - Intronic
1001688035 5:173610299-173610321 TTAAGCCTTCGGGTAAAAATAGG + Intronic
1004627074 6:17386943-17386965 ATAACACTTAGGACAAAATAGGG - Intergenic
1005508868 6:26494156-26494178 AAAAGTCTTAGGGCCAAGTTTGG - Intergenic
1010062527 6:71640530-71640552 ATTATCTTTGGGGCAAAATTTGG - Intergenic
1010888867 6:81280224-81280246 AAAATACTTAGGGAAAAATTTGG + Intergenic
1013039152 6:106416470-106416492 ATAAGCCTGAGGTTAAAAATGGG + Intergenic
1013051272 6:106537953-106537975 ATGTGCCTTGGGCCAAAATTGGG + Intronic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1014854969 6:126389036-126389058 TTAAGTCTTGGGGAAAAATTAGG - Intergenic
1017549076 6:155484890-155484912 AGAAGATGTAGGGCAAAATTAGG + Intergenic
1024190364 7:47000515-47000537 ATAAGCCTCAGGGCAAACACAGG + Intergenic
1025169955 7:56747644-56747666 ATTATCCTTAAAGCAAAATTAGG + Intergenic
1028098689 7:86793743-86793765 ACAAGCCTAAGTGGAAAATTAGG - Intronic
1034841947 7:154406380-154406402 ATCAACCTTTGGGAAAAATTAGG + Intronic
1038351985 8:26784735-26784757 ATAAGCCTTATGAAAAACTTAGG - Intronic
1043128696 8:76433422-76433444 TCAAGCCTCAGGGGAAAATTTGG + Intergenic
1044949570 8:97422392-97422414 ATCATCTTTACGGCAAAATTAGG - Intergenic
1045089046 8:98720051-98720073 ATAAGCCTTAATACTAAATTGGG - Intronic
1047615640 8:126560270-126560292 GGATGCCTTAGGGGAAAATTTGG + Intergenic
1047779109 8:128097384-128097406 CTAAGCCTTTGGGCTAAATCTGG + Intergenic
1047839871 8:128739657-128739679 CTAGAACTTAGGGCAAAATTTGG + Intergenic
1048084873 8:131166299-131166321 TTAAGCCTTGGGCCAAATTTGGG + Intergenic
1048540231 8:135335339-135335361 CTAGGCCTGAAGGCAAAATTAGG - Intergenic
1052135211 9:24900816-24900838 AGAAAGCTTAGAGCAAAATTTGG - Intergenic
1052329208 9:27250483-27250505 ATAAGCCTAAAGACAAAATATGG + Intergenic
1057341956 9:94210820-94210842 AAAAGCCTCAGGGAAACATTAGG + Intergenic
1058611970 9:106787469-106787491 ATAATTCTTAGTGCAAAAATGGG + Intergenic
1187188243 X:17008634-17008656 ATAAGAATTAGGGCAAGATTGGG + Intronic
1187272216 X:17789425-17789447 AGAAGCCTGAAGGCAAAATTGGG - Intergenic
1188729280 X:33626641-33626663 ATAAGCATTAGAGCACATTTTGG + Intergenic
1189543297 X:42015186-42015208 ATAAGACTTTGTGGAAAATTAGG - Intergenic
1190944428 X:55077099-55077121 ATGAGCTTTAGGCAAAAATTTGG - Intronic
1190945672 X:55091032-55091054 ATGAGCTTTAGGCAAAAATTTGG - Intronic
1190958616 X:55222326-55222348 ATGAGCTTTAGGCAAAAATTTGG - Intronic
1190964220 X:55282420-55282442 ATGAGCTTTAGGCAAAAATTTGG - Intronic
1193508168 X:82368781-82368803 ATAACCCTTATGGCATATTTTGG + Intergenic
1193538747 X:82745262-82745284 ATAATCCTTATGGCAAATCTTGG + Intergenic
1194386264 X:93259072-93259094 ATGAGACTTTGGGCAAAATTTGG + Intergenic
1198727646 X:139693263-139693285 CTAAGCATTAGAGCAAAATTGGG - Intronic