ID: 928635139

View in Genome Browser
Species Human (GRCh38)
Location 2:33237833-33237855
Sequence GCAAGAAGGCCCTGAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928635132_928635139 26 Left 928635132 2:33237784-33237806 CCTAGAAAGATTCTGGATTGACA 0: 1
1: 0
2: 2
3: 14
4: 235
Right 928635139 2:33237833-33237855 GCAAGAAGGCCCTGAGGAAAGGG 0: 1
1: 0
2: 5
3: 33
4: 333
928635135_928635139 -6 Left 928635135 2:33237816-33237838 CCTTGACTTGGTCAAGAGCAAGA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 928635139 2:33237833-33237855 GCAAGAAGGCCCTGAGGAAAGGG 0: 1
1: 0
2: 5
3: 33
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928635139 Original CRISPR GCAAGAAGGCCCTGAGGAAA GGG Intronic