ID: 928635530

View in Genome Browser
Species Human (GRCh38)
Location 2:33241758-33241780
Sequence TTTTACTTGGGACATATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928635520_928635530 20 Left 928635520 2:33241715-33241737 CCAGCCTTCTTGACCACAACTGG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG 0: 1
1: 0
2: 2
3: 16
4: 200
928635522_928635530 16 Left 928635522 2:33241719-33241741 CCTTCTTGACCACAACTGGCTGG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG 0: 1
1: 0
2: 2
3: 16
4: 200
928635526_928635530 -10 Left 928635526 2:33241745-33241767 CCCAAACTTGAGGTTTTACTTGG 0: 1
1: 0
2: 1
3: 9
4: 154
Right 928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG 0: 1
1: 0
2: 2
3: 16
4: 200
928635524_928635530 7 Left 928635524 2:33241728-33241750 CCACAACTGGCTGGTTACCCAAA 0: 1
1: 0
2: 0
3: 14
4: 317
Right 928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG 0: 1
1: 0
2: 2
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928635530 Original CRISPR TTTTACTTGGGACATATAAT AGG Intronic
901881770 1:12198319-12198341 TGATTCTTGGGCCATATAATGGG - Intronic
903327825 1:22581391-22581413 GTTCACCTGGGACAAATAATTGG - Intronic
903631064 1:24771726-24771748 TTGAACTTGAGACATGTAATTGG + Intronic
908138934 1:61162639-61162661 TTTTCCATGGGACAGATAGTGGG - Intronic
908687872 1:66742252-66742274 TTTTATTTGGCACAAACAATGGG + Intronic
908957492 1:69651396-69651418 TTTGAATTGGCAGATATAATTGG - Intronic
909712093 1:78663198-78663220 CTTTACTTGGGACCTAGAACTGG + Intronic
911845342 1:102745730-102745752 GTTTCCTTGTAACATATAATGGG + Intergenic
912558333 1:110532065-110532087 CTTTGCTTGGGACCTATATTGGG + Intergenic
913552524 1:119929482-119929504 TTTGAGATGGGACAAATAATAGG - Intronic
913687426 1:121246058-121246080 TGTTACTTGGGAGTTGTAATGGG + Intronic
914039288 1:144033703-144033725 TGTTACTTGGGAGTTGTAATGGG + Intergenic
914150171 1:145034233-145034255 TGTTACTTGGGAGTTGTAATGGG - Intronic
916654998 1:166867355-166867377 TTTAACTTTGGACATAAAAGAGG + Intronic
917474179 1:175354157-175354179 CTTTACTTGGTGCATTTAATTGG + Intronic
920474754 1:206264578-206264600 TGTTACTTGGGAGTTGTAATGGG + Intronic
920550219 1:206854436-206854458 TGTTACATGGGAAATAAAATCGG - Intergenic
920897655 1:210073547-210073569 TTTTACTTATGACATAAATTGGG - Intronic
1062853829 10:769037-769059 TTTTAATTGGGAAAAATATTTGG + Intergenic
1064247240 10:13678788-13678810 TTTTAATTGGCACATAATATGGG + Intronic
1068056643 10:52019675-52019697 TTTTATTTGGGAGAAAGAATAGG + Intronic
1068226327 10:54111480-54111502 TTTTCTTTGGGTCATACAATGGG + Intronic
1068304612 10:55190827-55190849 TTTGACATGGTAGATATAATAGG + Intronic
1068629167 10:59282434-59282456 TTTTAATTTGGGCATATAGTAGG + Intronic
1073552580 10:104416789-104416811 TTCTACTAGGGCCACATAATGGG + Intronic
1073674864 10:105634453-105634475 TAGTACTTGGGACATAGGATAGG - Intergenic
1074624200 10:115162072-115162094 TGTTTCTTGGGATATATCATTGG + Intronic
1076929492 10:133520582-133520604 TTTTACTTGGAACAGATGTTTGG + Intronic
1077916295 11:6613616-6613638 ATATACTTGGGAAATATAATTGG + Exonic
1091054781 11:132407717-132407739 TTTTAGTTGGGACAAACAACAGG - Intergenic
1091905620 12:4186221-4186243 TCTTATTGAGGACATATAATAGG - Intergenic
1092586496 12:9906260-9906282 TTTTCATTGGGAGAGATAATGGG + Intronic
1092658076 12:10708603-10708625 TTTTACTTCTGACATGGAATAGG + Intronic
1093621958 12:21302436-21302458 TTTTACTTAGTAAATAGAATAGG - Intronic
1099580403 12:84439423-84439445 TTTTACTGGGTCCTTATAATTGG - Intergenic
1099772002 12:87072637-87072659 TTTTTCTTTTTACATATAATTGG + Intergenic
1101171640 12:102103245-102103267 TTGAACTTGGCACAAATAATTGG - Intronic
1105062552 12:133166558-133166580 TTTGACCTGGGTCATATAAGTGG - Intronic
1105709021 13:22987574-22987596 TTTCACTTGGGACATTTTATTGG - Intergenic
1106878517 13:34103629-34103651 TTTTAATTGGATCAAATAATTGG - Intergenic
1107021818 13:35759867-35759889 TTTTACTTGGGTGATATGGTGGG - Intergenic
1108705585 13:52982560-52982582 TTTTATTAGGGAGATACAATGGG - Intergenic
1110824509 13:79957153-79957175 TTTCAGTTGGGATAAATAATAGG + Intergenic
1111088251 13:83405188-83405210 ATTTACTTGGTAAATAAAATTGG + Intergenic
1117919872 14:60718345-60718367 TTTTAAATGGGACATTTAATAGG - Intronic
1118750003 14:68798989-68799011 TTTTAGTTGGGTCATTTAGTTGG + Intergenic
1120381769 14:83789617-83789639 TTTTATTTGGGCCAGAGAATGGG - Intergenic
1127243107 15:57140645-57140667 ATTTATTTGGGACACATAGTGGG + Intronic
1129045701 15:72732187-72732209 TTTTACTGTGGTTATATAATTGG + Intronic
1131484214 15:92807159-92807181 TTTTACCTGGAACAAGTAATAGG + Intronic
1135762919 16:25152008-25152030 TTATACATGGGACCTATGATGGG - Intronic
1138176873 16:54908351-54908373 TTTCCCTAAGGACATATAATGGG - Intergenic
1138950952 16:61912254-61912276 TTTCATTTGGGCCATAAAATAGG + Intronic
1144422839 17:15113824-15113846 TTTGATTTGGGACTTATAATAGG - Intergenic
1149324483 17:55516124-55516146 TTTTACTGGGAAGATATAAAAGG - Intergenic
1149671457 17:58416430-58416452 TTTTAACTGGGAAAAATAATTGG - Exonic
1150499748 17:65639177-65639199 TTTTACTAGGGGAATATAAAAGG + Intronic
1153296025 18:3547424-3547446 TTTTAATTGGGTTATTTAATTGG - Intronic
1153449836 18:5214949-5214971 TTTTTTTTGGGCTATATAATGGG - Intergenic
1154373606 18:13789960-13789982 TTGTAGTTGGGCCATATACTTGG + Intergenic
1155370921 18:25099575-25099597 TATGACTTGGGACAAATAAAAGG - Intronic
1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG + Intergenic
1156902389 18:42315683-42315705 TTGTACTTAGTACATATAGTGGG - Intergenic
1158552514 18:58448296-58448318 TTTTACTAGCGATATATTATTGG + Intergenic
1163939896 19:20481898-20481920 TCTTAGTAGGGACATAAAATGGG + Intergenic
1164465967 19:28487997-28488019 TTCTTGTTGGGACAGATAATAGG - Intergenic
1168212682 19:54902025-54902047 TTTTACCAGTGACATATATTTGG - Intergenic
925847535 2:8047264-8047286 TTTTACTTATGACCTATAAATGG - Intergenic
927388866 2:22569756-22569778 TTCTGCTTAGTACATATAATTGG + Intergenic
927668660 2:25050491-25050513 TTTTCCATGGTACATAAAATGGG + Intronic
928167934 2:28984269-28984291 TTTTGCCTGGGAAATATAAATGG - Intronic
928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG + Intronic
929344741 2:40867715-40867737 TTTTAAGGGGCACATATAATGGG - Intergenic
929768416 2:44870266-44870288 TTTGACTTAGAAAATATAATCGG + Intergenic
930311920 2:49752933-49752955 TTTGACTTGGGAAATATGAGAGG + Intergenic
930459978 2:51661589-51661611 TAGTACTGGGGAAATATAATTGG + Intergenic
930699262 2:54443029-54443051 TTTTACATTAGACATAAAATTGG + Intergenic
931180713 2:59897760-59897782 TATTACCTGGTACATAGAATAGG + Intergenic
938965825 2:136387674-136387696 TCTTATTTGGAACATATCATTGG + Intergenic
939287156 2:140146759-140146781 ATTTAATTGGGACATAAAAGGGG - Intergenic
939345157 2:140955657-140955679 TTTTAAGTGAAACATATAATAGG - Intronic
939380926 2:141435492-141435514 CTTTATTTGGGACAGATTATGGG - Intronic
939536281 2:143434069-143434091 TTTTACTGGATACATAAAATAGG + Intronic
940448557 2:153809035-153809057 ATTTACTAGGGAAATATAATAGG - Intergenic
940920134 2:159296890-159296912 TTTTTCTTTGGAAAAATAATTGG - Intergenic
942436109 2:175978609-175978631 ATTTACTGGGGAACTATAATAGG + Intronic
944620772 2:201513575-201513597 TTTTTCTTTGGATATATAACTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169668686 20:8069940-8069962 TTTTAACAGGGAAATATAATAGG + Intergenic
1170036980 20:11999988-12000010 TTTTACTGAGGACATATAATTGG + Intergenic
1170495596 20:16921459-16921481 TATTACTTGGGAAATTTTATAGG + Intergenic
1170724984 20:18918342-18918364 TTTCACTTGGGAGAGATAAATGG - Intergenic
1172789957 20:37496272-37496294 TTTGACTTGGGACTTGTAAGGGG - Intronic
1173942507 20:46923594-46923616 TTTTTCTTGGGAAATACCATTGG + Intronic
1175123164 20:56732192-56732214 CTTTGCTTGGGTCATGTAATGGG + Intergenic
1175261708 20:57678746-57678768 TATTACTTGGGGCAGACAATAGG - Intronic
1177388743 21:20440174-20440196 TTATACTTGGAATATATAATTGG - Intergenic
1178277097 21:31248949-31248971 TTTTACTTGGGACATATCAGAGG - Intronic
1182399366 22:30062862-30062884 TTTTACTTGGGAAGTTTAAAAGG - Intergenic
1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG + Intergenic
1183557350 22:38540492-38540514 TTTTACTTCAGACATATTGTTGG - Intronic
1184115691 22:42420873-42420895 TTAAACTTGGGTCATCTAATAGG + Intronic
1184414606 22:44344986-44345008 TTGTCCTTGGAAAATATAATGGG + Intergenic
950346564 3:12299797-12299819 TTTTTCTTGGGAGATAAAGTTGG + Intronic
952172375 3:30822042-30822064 TTTCACTTGGTACACCTAATGGG + Intronic
952552977 3:34500016-34500038 TTTTATTTCTGAAATATAATAGG - Intergenic
952778579 3:37070991-37071013 TTTTGCTTGGGAAATATAAGAGG - Intronic
955246581 3:57230093-57230115 ATTTACTTGGGAAAATTAATTGG + Intronic
957709240 3:83833790-83833812 TTTTATTTGGCATATATACTAGG - Intergenic
960455497 3:117866341-117866363 TTTTATGTGGAACATATACTTGG + Intergenic
963332986 3:143937133-143937155 TTTAACTTGGCATATTTAATTGG - Intergenic
964096367 3:152935889-152935911 TTTTACTGGGCACATATTTTTGG - Intergenic
964765768 3:160177547-160177569 TTTTACTTGGGAAGGATATTTGG + Intergenic
966180474 3:177183799-177183821 TTTTTCTTGAAACATCTAATCGG + Intronic
967932123 3:194697494-194697516 TTTTATTTGTTCCATATAATGGG + Intergenic
971411825 4:26381587-26381609 TTTTACTTATGACATATATATGG + Intronic
971500751 4:27315643-27315665 TTTTACCAGGCTCATATAATAGG - Intergenic
973069678 4:45842059-45842081 TTTTTCTTTAGACATAAAATGGG - Intergenic
974226303 4:59049881-59049903 ATCTACTTGGAACATATAATTGG + Intergenic
974557991 4:63477117-63477139 TTTTACTTGTGACATCTTACAGG - Intergenic
978487577 4:109273031-109273053 TTTTTCATGGGGCATATATTGGG - Intronic
979837447 4:125389003-125389025 TTTTGTTTGAGAAATATAATTGG + Intronic
979933465 4:126662294-126662316 TTTTACTTGTCACATAGGATAGG + Intergenic
980169888 4:129276373-129276395 ATTTACTAGAGAAATATAATTGG - Intergenic
981121284 4:141053557-141053579 TTTAAATTGGGAGATATAATGGG + Intronic
981135929 4:141211511-141211533 TTGTACTTGGAAGAAATAATAGG - Intronic
981185693 4:141800066-141800088 TTTTACTTGGGGCTAGTAATTGG + Intergenic
981728362 4:147871709-147871731 ATGTACTTGGAACTTATAATTGG + Intronic
982047524 4:151463674-151463696 TTTTCTTTGTGACACATAATTGG - Intronic
987212839 5:15701546-15701568 ATTTACTGGATACATATAATGGG + Intronic
987334009 5:16882844-16882866 TTCTACTGGGCACCTATAATGGG + Intronic
988748049 5:34163698-34163720 TTTTAATTTGAAAATATAATAGG - Intergenic
989088722 5:37705888-37705910 ATTTACTGGACACATATAATTGG + Intronic
989149939 5:38289314-38289336 TTTTACTTGAAACCTGTAATAGG + Intronic
990973205 5:61532590-61532612 TTTTGCTTTGGACAAATAAAAGG - Intronic
991207249 5:64063713-64063735 TTTTACTTACGTCATATAAGTGG + Intergenic
991578536 5:68130413-68130435 TTTTTCTAGGGACACATAAAAGG - Intergenic
992282362 5:75193693-75193715 TTGTACTTGGATCCTATAATAGG - Intronic
992370836 5:76142655-76142677 TTTTGTTTGGGACATTTAGTTGG + Intronic
994427818 5:99616515-99616537 TTTTACTTGAGACTTATTTTTGG - Intergenic
995672508 5:114622771-114622793 TTTGACTTAGGACAAATGATAGG + Intergenic
996044649 5:118857372-118857394 TTTTACTTTGGCCATATGTTGGG + Intronic
997391689 5:133522311-133522333 ATTTTCTTGGGAAATTTAATAGG - Intronic
997575085 5:134968764-134968786 TTTCATTTGTAACATATAATGGG + Exonic
998753052 5:145345746-145345768 TTTGACTTGTGAAATATAAAGGG + Intergenic
999908786 5:156172859-156172881 TTTAACTTGATACATATTATTGG + Intronic
1001893123 5:175355981-175356003 TTTCACTTGGGACCTCCAATAGG - Intergenic
1003190396 6:3869545-3869567 TTTCACCTGGGCCAGATAATGGG + Intergenic
1005218359 6:23557897-23557919 TTTTATTTGGGAATTAGAATTGG - Intergenic
1005443302 6:25894693-25894715 TTTTAAATGAGATATATAATAGG + Intergenic
1006203112 6:32314442-32314464 TTGCACATGGGCCATATAATTGG - Intronic
1007089169 6:39171391-39171413 TTTTTATTAGGACACATAATAGG + Intergenic
1007470924 6:42089691-42089713 TTTTACATGGAACACATTATTGG + Intergenic
1007502850 6:42311987-42312009 TTTTATTTCAGACATATCATGGG + Intronic
1009675228 6:66811421-66811443 TTTTTCTTGGAAAATATAATGGG + Intergenic
1010718620 6:79258337-79258359 TTTTACTAAAGACATATCATGGG + Intergenic
1012305830 6:97655970-97655992 TTCTACTTGTGAAATATAGTAGG + Intergenic
1012358512 6:98347112-98347134 ATATAATTGGGAAATATAATTGG - Intergenic
1013878285 6:114861752-114861774 TTTCACTTGAGAAAAATAATTGG - Intergenic
1014654331 6:124080602-124080624 TTTTAATTGGGAAATGTAGTTGG - Intronic
1015722540 6:136258587-136258609 TATTACTTGTGACATTTTATTGG + Exonic
1015764885 6:136705947-136705969 TTTTCATTGAGAAATATAATGGG + Intronic
1016198678 6:141379407-141379429 TTTTATTTGGGAAAAAGAATAGG + Intergenic
1018342224 6:162863010-162863032 TTTTACTTATGACATAGACTTGG - Intronic
1018624279 6:165762756-165762778 TTTTCTCTGGGACATATATTTGG + Intronic
1019201574 6:170320730-170320752 TTTTACTTTACACATAAAATAGG - Intronic
1021004197 7:15372860-15372882 TTTTAATTTGGACGTATGATCGG + Intronic
1021770340 7:23994374-23994396 TTTTACTAGGAAAGTATAATAGG + Intergenic
1024894214 7:54238585-54238607 TTTAAATTGTGACATATAACTGG - Intergenic
1027614580 7:80405662-80405684 ATGTACTTGGGATATATAATTGG + Intronic
1030254013 7:107486548-107486570 TTTTAATAGGAAAATATAATTGG - Intronic
1030440967 7:109588815-109588837 AATTATTTGGGACAAATAATAGG + Intergenic
1030544881 7:110880646-110880668 TTTTACTTGTAAGATGTAATTGG - Intronic
1031206611 7:118766930-118766952 ATGTACTTTGGACATATAAGAGG + Intergenic
1031656185 7:124359188-124359210 TTTTACTTCAAACATAAAATTGG - Intergenic
1033266512 7:139891855-139891877 TTTTACTGGAGACAAATAAAAGG + Intronic
1035414481 7:158671473-158671495 TTTTACTTATGACATGAAATAGG - Intronic
1037098662 8:15016462-15016484 TTTTACCTGAGACATCTATTGGG - Intronic
1038250379 8:25898588-25898610 TTTTAGTTGGGAAAAGTAATGGG - Intronic
1039771983 8:40696637-40696659 TTTTACTTGTGAAAGTTAATAGG + Intronic
1040008736 8:42643127-42643149 TTGTATTTGGAACATAAAATAGG + Intergenic
1040712302 8:50204178-50204200 TCTTACTTGGCACATATCTTCGG - Intronic
1041551870 8:59111893-59111915 TTTTGCTTGGGAGATTTAAATGG - Intronic
1041844247 8:62309200-62309222 TCTTAATTTGGACATATAACAGG - Intronic
1042467360 8:69142666-69142688 TTTTCTTTGTCACATATAATGGG + Intergenic
1044369566 8:91392736-91392758 TTTTACTTGGGACATTGAGGAGG + Intronic
1044675369 8:94722481-94722503 TCTTACATGGGACAATTAATGGG + Intronic
1045909101 8:107384619-107384641 TTTTATTGGGGACTTATAAGAGG + Intronic
1046193951 8:110834635-110834657 TTTTAATTGGGAGACAGAATAGG + Intergenic
1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG + Intergenic
1046467452 8:114624614-114624636 TATTATTTAGGACATAAAATAGG + Intergenic
1047129150 8:121999469-121999491 TTTTATTTGGGAAATTTATTTGG + Intergenic
1050116966 9:2273241-2273263 TTTTAATTGAGAAAAATAATTGG + Intergenic
1050331024 9:4546325-4546347 TATTACATGGGACAAATAATTGG - Intronic
1051241742 9:15064145-15064167 TTTAAGTTGGGAAATATAACTGG - Intergenic
1052086649 9:24275605-24275627 TTTTGTTTGGAAGATATAATAGG + Intergenic
1052088634 9:24298662-24298684 TTTTACCTGAAAGATATAATTGG + Intergenic
1052123428 9:24746703-24746725 TTTTACTTAGAATATATATTTGG + Intergenic
1052634365 9:31082350-31082372 ATTTAGTTGCGACATTTAATTGG - Intergenic
1053151274 9:35744791-35744813 ATGTCCTTGGGACATTTAATGGG - Intronic
1054744565 9:68841637-68841659 TTTAACTTGGGACAAAAAAAAGG + Intronic
1057932080 9:99202566-99202588 TTTTCCTTGGAACATATTATAGG + Intergenic
1058343615 9:103929899-103929921 TTTCACCTGGGATATATTATTGG - Intergenic
1059068009 9:111105398-111105420 TTTTACGTGGATCATAGAATGGG - Intergenic
1203654380 Un_KI270752v1:8661-8683 TTGGACTTGGGAAATGTAATTGG + Intergenic
1186695526 X:12026811-12026833 TTTTTCTTGTAATATATAATGGG + Intergenic
1188154118 X:26719740-26719762 TTTTATTGGGCACATAAAATAGG + Intergenic
1189686521 X:43569738-43569760 TTTTAATTGGCACATATTTTGGG - Intergenic
1192288226 X:69761671-69761693 TTCTACTGGGGACATTTGATAGG + Intronic
1193528736 X:82627274-82627296 TAATACTTGGGAGATAAAATAGG - Intergenic
1194050194 X:89058599-89058621 TTTTAGTTAGGAAATATAAATGG - Intergenic
1195674072 X:107493805-107493827 TTTAACTTTTAACATATAATTGG - Intergenic
1196239639 X:113327277-113327299 TTTTATTTTGGACATATACTTGG - Intergenic
1197013035 X:121590307-121590329 TTTTAATTGGCTCACATAATTGG + Intergenic
1197399825 X:125976726-125976748 TATTACTTGTGAAATATAATAGG - Intergenic
1197884062 X:131199814-131199836 TTTTTATTGGGATACATAATAGG - Intergenic
1199295597 X:146154512-146154534 TATTAGTTGGGAAATATGATCGG + Intergenic
1200843391 Y:7806742-7806764 TTGAACTTGTGACATATACTTGG - Intergenic
1200880469 Y:8207116-8207138 ATTTCCTTGTGACATTTAATGGG + Intergenic