ID: 928645223

View in Genome Browser
Species Human (GRCh38)
Location 2:33345087-33345109
Sequence CAGTGTGAAGTGCGTATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928645223_928645226 -2 Left 928645223 2:33345087-33345109 CCTATGATACGCACTTCACACTG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 928645226 2:33345108-33345130 TGGGTGTTCTGTAGAGCTACAGG 0: 1
1: 0
2: 0
3: 4
4: 108
928645223_928645227 -1 Left 928645223 2:33345087-33345109 CCTATGATACGCACTTCACACTG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 928645227 2:33345109-33345131 GGGTGTTCTGTAGAGCTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928645223 Original CRISPR CAGTGTGAAGTGCGTATCAT AGG (reversed) Intronic
901383269 1:8889381-8889403 CAGTGTGAAGTTCGTACTCTGGG + Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
921706691 1:218329555-218329577 CAGTGTGACGTGAGAAGCATTGG + Intronic
1063166567 10:3468780-3468802 AAATGTGAAGTGCGTGTCATAGG - Intergenic
1085017534 11:73185301-73185323 CAGTGTGAAGTGCCCTTCCTGGG - Intergenic
1089967939 11:122669195-122669217 AAGTCTGAAATGCATATCATAGG + Intronic
1090615892 11:128514554-128514576 CAGTGTTAAGTTAGTTTCATAGG - Intronic
1093414506 12:18904804-18904826 CTGTGGTAAGTGCTTATCATGGG - Intergenic
1099068835 12:78019521-78019543 AAGTATGAAGTGCTTATAATTGG + Intronic
1112042412 13:95559923-95559945 CACTGTGAAGTGCGGTTTATGGG - Intronic
1112184831 13:97117636-97117658 CAGTGTGAAGTGCTAATAGTTGG + Intergenic
1115919069 14:38352561-38352583 CAGTGTGAAGGGCAAATAATAGG + Intergenic
1116559916 14:46364712-46364734 CAGTGTCAGGTGCATATCTTGGG - Intergenic
1120144561 14:80965445-80965467 CTGTGTGAAGAGCCTATCAAGGG - Intronic
1128934237 15:71731836-71731858 AAGTCTGAAGTGGGTTTCATTGG + Intronic
1129627579 15:77218829-77218851 CAGTGTGAAATGGGTAGCAATGG - Intronic
1138361181 16:56428810-56428832 CTGTGTGTAGTCCATATCATTGG - Intergenic
1140145074 16:72299079-72299101 CAGGGTGAAGTGCATATAACAGG - Intergenic
1150563211 17:66313042-66313064 CAGTGTGAAGGTCCTATGATAGG - Intronic
1151016745 17:70563236-70563258 TAGTGTGAAGTCTTTATCATGGG - Intergenic
1158703307 18:59768912-59768934 CAGTTTCAAGTGGGTGTCATGGG + Intergenic
1159168073 18:64726583-64726605 CAGTGTAAAGTGGGTTCCATGGG + Intergenic
1160036032 18:75302572-75302594 ACGTGTGAAGAGCCTATCATGGG - Intergenic
1167443697 19:49525160-49525182 CAGTGGGAAGTCAGTCTCATGGG - Intronic
926542162 2:14194348-14194370 CAGTGTGCTGTGAGTATCAAGGG + Intergenic
928645223 2:33345087-33345109 CAGTGTGAAGTGCGTATCATAGG - Intronic
929105695 2:38363714-38363736 CAGTGTGAAGTAGGTAGGATGGG - Intronic
931214571 2:60228928-60228950 AAGTCTGAAGTGAGTATCACTGG - Intergenic
932323031 2:70835735-70835757 CACAGTGAAGTGCGCATCAGGGG + Exonic
939618479 2:144388695-144388717 CAGTGTTAAGAGGGTAACATGGG - Exonic
944445776 2:199786858-199786880 AAGTCTGAAGTGGGTCTCATTGG + Intronic
945058851 2:205891111-205891133 CAGTGTGAAGTGACTTTCACTGG + Intergenic
1171358372 20:24567786-24567808 CCATGTGATGTGCGTATGATGGG + Intronic
1175137213 20:56833190-56833212 CACTGTGAAGTGCTTGACATAGG - Intergenic
1179832717 21:44007819-44007841 CAGTGTGAGGAGCTTATCAGTGG + Intergenic
955377966 3:58413786-58413808 CTGTGTGAAGGGAGAATCATTGG + Intronic
962606802 3:137038882-137038904 CAGTCTGAAATGGGTATTATGGG - Intergenic
964537126 3:157735191-157735213 CAGTAGGAAGTTTGTATCATGGG + Intergenic
964965555 3:162488567-162488589 AAGTGTGAAGTGCTTATCAAGGG + Intergenic
979543272 4:121910845-121910867 GAGTGTGATATGAGTATCATTGG - Intronic
983475622 4:168208502-168208524 TAGTGTGAAGTGGGGCTCATTGG + Intergenic
983526485 4:168765512-168765534 CAGTGTGAAGTGGGTGACAGTGG - Intronic
986785758 5:11112499-11112521 CAGTCTGAAGTGGGTCTCACTGG - Intronic
1007582409 6:42967354-42967376 CGGTGTGCAGTGAGTATCAAGGG - Exonic
1012141365 6:95630529-95630551 CAGTGGGAAGTGATTATTATGGG + Intergenic
1016534971 6:145099696-145099718 CAGGGTGAAGTTCGTTTCCTTGG + Intergenic
1036611907 8:10357775-10357797 CAATGTGTAGTGCGTATGTTGGG + Intronic
1039810301 8:41041993-41042015 CAGTGTTAGGTGCATATTATGGG + Intergenic
1041796966 8:61755348-61755370 TATTGTGAATTGCGTATCCTGGG - Intergenic
1047641392 8:126825225-126825247 TAGTGTGAAGTGCATGTCATAGG + Intergenic
1056661491 9:88547037-88547059 CAGTGTGATGTGGGCACCATGGG + Intronic
1059267801 9:113052014-113052036 CAGTGTCCTGTGGGTATCATTGG - Intronic
1060078928 9:120622720-120622742 CAGTGCAAAGTGGGTGTCATTGG - Exonic
1188535692 X:31194337-31194359 CAGTGTGGACTGCATATCAGAGG + Intronic
1198565359 X:137898780-137898802 CAATGTGAAGTGTGTTACATGGG + Intergenic
1199386178 X:147225910-147225932 CAGTGTGCAGTGCCTTTCACAGG - Intergenic