ID: 928646782

View in Genome Browser
Species Human (GRCh38)
Location 2:33362624-33362646
Sequence AAGTTAACACAGATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 616}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928646782_928646786 18 Left 928646782 2:33362624-33362646 CCATTTTCCATCTGTGTTAACTT 0: 1
1: 0
2: 5
3: 65
4: 616
Right 928646786 2:33362665-33362687 AGTCTTCAGGTTGTAAAATGAGG 0: 1
1: 0
2: 1
3: 18
4: 198
928646782_928646785 5 Left 928646782 2:33362624-33362646 CCATTTTCCATCTGTGTTAACTT 0: 1
1: 0
2: 5
3: 65
4: 616
Right 928646785 2:33362652-33362674 AAGTCATCTATGGAGTCTTCAGG 0: 1
1: 0
2: 2
3: 11
4: 134
928646782_928646784 -5 Left 928646782 2:33362624-33362646 CCATTTTCCATCTGTGTTAACTT 0: 1
1: 0
2: 5
3: 65
4: 616
Right 928646784 2:33362642-33362664 AACTTTAAGCAAGTCATCTATGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928646782 Original CRISPR AAGTTAACACAGATGGAAAA TGG (reversed) Intronic
901153448 1:7120072-7120094 AAGATCACACAGATGGCAAATGG + Intronic
901879079 1:12183337-12183359 GAGATAACAGAGATGGAAAAAGG - Intronic
901896484 1:12317345-12317367 AAGATAACACAGCTCGTAAATGG + Intronic
902393741 1:16120820-16120842 AAGGTCACAAAGATGGATAAGGG - Intergenic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
903556018 1:24193928-24193950 AAGGTCACACAGGTGGAAATGGG + Intergenic
903946941 1:26969927-26969949 AAGTTCACACAGTTAGGAAAAGG - Intergenic
903949943 1:26990836-26990858 AAGTTCACACAGCAGGTAAATGG - Intergenic
904484692 1:30816920-30816942 AAGATCACACAGCTGGAAGATGG - Intergenic
904525037 1:31127034-31127056 AAATTGACCCAGAAGGAAAAGGG + Intergenic
904707112 1:32399826-32399848 AAGGTAACACAGCTAGGAAATGG + Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905758427 1:40532244-40532266 CAGTTAACTCATATGCAAAATGG - Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906300685 1:44679388-44679410 AAATTAGCACTAATGGAAAATGG - Intronic
906651899 1:47518771-47518793 AAGGTTACACAGTTGGAAAGTGG - Intergenic
907383005 1:54106948-54106970 AAGTTAACAATGGTGGAAACTGG - Intronic
907648249 1:56265962-56265984 AAGTTTACACAAATGGTAAGTGG - Intergenic
907827260 1:58030745-58030767 GAGTGAACACATATGGAAATAGG + Intronic
907865972 1:58399531-58399553 AGGTTCACACAGCTGGTAAATGG + Intronic
907928002 1:58972804-58972826 AAGTTCACACAGTTGGGAAGAGG + Intergenic
908076879 1:60529475-60529497 AAGATGACATAGCTGGAAAATGG - Intergenic
908173524 1:61531174-61531196 AGGTGAACAGAGATGGGAAAAGG + Intergenic
908421721 1:63965185-63965207 ACGTTAACACAGCTGGTAAATGG + Intronic
908640488 1:66217571-66217593 TAGGTCACAAAGATGGAAAATGG + Intronic
908791066 1:67782107-67782129 AAGGCAAAACAGATGTAAAAGGG + Intronic
909046605 1:70718146-70718168 AAGTTTACACAGCTGGCAAATGG + Intergenic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909387272 1:75072702-75072724 AAGTTAACAAAGTTTCAAAATGG + Intergenic
909822148 1:80079211-80079233 ATGGTAACACAGATAGCAAAAGG + Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910440068 1:87242646-87242668 AAGGTCACACAGTTGGTAAATGG + Intergenic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
910599430 1:89015024-89015046 GAGTTAACACAGATGCATAAAGG - Intronic
910603756 1:89060071-89060093 GGGTTAACACAGATGCATAAAGG - Intronic
910637071 1:89420422-89420444 GGGTTAACACAGATGCATAAAGG + Intergenic
910653343 1:89593429-89593451 AAGTTAATAAAGATGAAGAATGG + Exonic
910914932 1:92278513-92278535 AATTTAGGAGAGATGGAAAAAGG - Intronic
911495730 1:98628909-98628931 AATTTAAAAAATATGGAAAAAGG + Intergenic
911658198 1:100468557-100468579 AAGTTACCACAGAAGAAAAAAGG + Intronic
911797100 1:102089257-102089279 AAGAAAACCCAGAAGGAAAATGG - Intergenic
913492905 1:119398330-119398352 AACTTAACACAAATGGAACGAGG - Intergenic
913499402 1:119457203-119457225 AACTTAACACAAATGGAAGGAGG - Intergenic
914931119 1:151934386-151934408 ACGTTACCACACATGGCAAAAGG - Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
916349094 1:163828552-163828574 AAGGTCACACAGCTAGAAAATGG + Intergenic
916696428 1:167241826-167241848 AAGTTAACATAACTGGAAAGTGG + Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917053166 1:170948215-170948237 AAATTAACACAGAAGAAACAGGG + Intronic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
918060090 1:181053515-181053537 AAGTTAACACAGAAGGGAAAGGG + Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918503015 1:185219261-185219283 AAGGTCACACAGATGATAAAAGG - Intronic
918984059 1:191600638-191600660 AAGATAAGAAAGATTGAAAAAGG - Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
919517117 1:198539639-198539661 AAGGTCACACAGAGGGTAAATGG - Intronic
919982250 1:202649562-202649584 AAGGTCACACAGTTAGAAAAGGG + Intronic
920061699 1:203231225-203231247 CAGTTTACACAGATAGTAAATGG - Intronic
920456824 1:206107968-206107990 AAGTTGATACAGGTAGAAAAGGG + Intergenic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
921292037 1:213667208-213667230 AAGTTACAGCAGAGGGAAAATGG + Intergenic
921304784 1:213784972-213784994 AAGTAAAAAAAAATGGAAAAAGG + Intergenic
921835060 1:219770027-219770049 AATTTAAAAAAGATGGGAAATGG - Intronic
922386406 1:225088397-225088419 AAATTAACACAGATTAAACAGGG + Intronic
923085029 1:230696740-230696762 ATGTGAACACATTTGGAAAAGGG - Intergenic
924170694 1:241337051-241337073 AAGATCACACAGATGGAAAATGG - Intronic
924787696 1:247214488-247214510 GAATTATCACAGGTGGAAAAGGG - Intergenic
924871468 1:248051199-248051221 AAATTCACAGAGATGGAAAGTGG - Intronic
1065261717 10:23930769-23930791 AAGTTAACTCAGTGGGAACATGG + Intronic
1065451967 10:25868724-25868746 ACGTGACCACATATGGAAAAAGG - Intergenic
1066277372 10:33882043-33882065 AAGTTACCAAGGATGGACAAAGG + Intergenic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1067974370 10:51007360-51007382 AACTTAACTCGGATGGTAAAAGG - Intronic
1068083919 10:52350831-52350853 AATTTAACATATATGGAAAAGGG + Intergenic
1068676655 10:59776583-59776605 AAACTAATACAGCTGGAAAAGGG - Intergenic
1068806247 10:61196934-61196956 AAGATCACACAGCTAGAAAATGG + Intergenic
1069225035 10:65932539-65932561 AAGGTAACACAGATAGTAAGAGG + Intronic
1069243679 10:66174149-66174171 AAGCTCACACAGCTAGAAAAAGG + Intronic
1069693683 10:70371620-70371642 ACGGAAACCCAGATGGAAAAGGG + Intronic
1070580787 10:77717591-77717613 AAGTTGACTCATATGTAAAATGG - Intergenic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1071379313 10:85042277-85042299 AAGGTAACACAGAGGTCAAAGGG - Intergenic
1071509579 10:86252993-86253015 TACTTAACTAAGATGGAAAATGG + Intronic
1071749450 10:88458132-88458154 AAGCTAACCCAGATGGGAGATGG - Intronic
1073076323 10:100827516-100827538 AAGTTAACACAGGAGAAGAATGG - Intronic
1073481412 10:103788292-103788314 AGGTTCACACAGCTGGTAAAGGG + Intronic
1073581190 10:104666910-104666932 AAGGTAACACGGCTAGAAAATGG + Intronic
1074127519 10:110541045-110541067 GTGTTAACACAGATGGCCAAAGG - Intergenic
1074261147 10:111854748-111854770 AAGTTCACACAACTGGAAAGTGG - Intergenic
1074443832 10:113501682-113501704 AAGTTGTCAGAGAAGGAAAAGGG + Intergenic
1075143532 10:119863401-119863423 AAGCTAATTCAAATGGAAAAAGG - Intronic
1075576762 10:123583353-123583375 AAGTTCACACAGTTGGTAAGAGG + Intergenic
1075588274 10:123672857-123672879 AAGATCACACAGTGGGAAAATGG - Intronic
1075854842 10:125620817-125620839 AAATTCACAGAGATGGAAACTGG - Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1078355895 11:10631083-10631105 AAGCTAACACACAAGAAAAAAGG + Intronic
1078545358 11:12243001-12243023 AAGTAAACACAGATCGAGAAAGG + Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079153838 11:17925858-17925880 AAGATCACACAGCTGGTAAATGG - Intronic
1079901439 11:26191538-26191560 TAGTGAACAAAGATGGAAATGGG - Intergenic
1080079716 11:28201825-28201847 AATTTGACAAAGATGGAACAAGG + Intronic
1080438772 11:32271090-32271112 AAGACTACAAAGATGGAAAATGG + Intergenic
1080676581 11:34433488-34433510 AAGTTCACACAGTTTGTAAATGG + Intergenic
1080817114 11:35769238-35769260 GAGTGATCACAGACGGAAAATGG - Intronic
1081060878 11:38475084-38475106 ATGTCAACATAGATGTAAAATGG - Intergenic
1082002289 11:47399992-47400014 CAGTTATCTCAGCTGGAAAATGG - Intergenic
1084683226 11:70679293-70679315 AAGGTCACACAGCTGGCAAATGG + Intronic
1085191539 11:74629515-74629537 AAAATAACACAGAAGGAAAGAGG + Intronic
1085256788 11:75178463-75178485 AAGTTAAAAAACATGTAAAAAGG - Intronic
1085437148 11:76516847-76516869 AAGTTAATATAAATGGCAAAAGG - Intronic
1085754843 11:79193804-79193826 AAGGTCACACAGCTAGAAAATGG + Intronic
1085935731 11:81139531-81139553 TACTTAAAACAGGTGGAAAAAGG - Intergenic
1086038970 11:82451829-82451851 AAGGTGACACAGCTGGTAAATGG - Intergenic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1086600397 11:88626156-88626178 AAGGTTACAGAGATAGAAAATGG + Intronic
1086978440 11:93164879-93164901 AAGATAAAACAGAAAGAAAAAGG + Intronic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1087450292 11:98312334-98312356 AACCTAACACAGATGTAAATAGG + Intergenic
1088107956 11:106227049-106227071 AAGAAAACACATAAGGAAAATGG + Intergenic
1088169479 11:106979539-106979561 AAGATCTCACAGATAGAAAATGG - Intronic
1089493582 11:118897931-118897953 AGGTAAAGACAGAAGGAAAATGG + Exonic
1090047946 11:123352357-123352379 AGGTTAACACAGGTAGAAAATGG - Intergenic
1090167496 11:124565760-124565782 ATGTTACCACTGAAGGAAAATGG + Intergenic
1090338845 11:125997164-125997186 AAGTTCACATCGATGGTAAAAGG + Intronic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1090588828 11:128243024-128243046 AAGTTAAAAAAGAAGAAAAAAGG + Intergenic
1090642439 11:128740961-128740983 TTGTTAACCCAGAGGGAAAAAGG + Intronic
1091184239 11:133633363-133633385 AAGCTCACACAGTTGGTAAATGG + Intergenic
1091337398 11:134782697-134782719 ATTTTAATACTGATGGAAAATGG - Intergenic
1091648015 12:2288482-2288504 AAGCTGACTCAGAGGGAAAATGG - Intronic
1091691488 12:2600392-2600414 AAGCAAACACAGAGGGAAATGGG - Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091888494 12:4033615-4033637 AAGATCACAGAGAAGGAAAAAGG - Intergenic
1092043467 12:5406220-5406242 AAGTTCACACAGACAGCAAAGGG + Intergenic
1092622654 12:10289709-10289731 AACTTGATACAGATGCAAAAAGG + Intergenic
1093508611 12:19899802-19899824 AAGATAATACAGAAGAAAAATGG - Intergenic
1094107621 12:26831258-26831280 AAAGTAACACTGATGGAAAAGGG + Intronic
1095453945 12:42362741-42362763 GATTTCCCACAGATGGAAAAAGG - Intronic
1095801646 12:46275211-46275233 AAGGTGATACAGCTGGAAAAAGG + Intergenic
1095861902 12:46926524-46926546 AAGTTTAAAAAGAAGGAAAAAGG + Intergenic
1095874587 12:47066884-47066906 AAGATCACACAGCTGGTAAATGG - Intergenic
1096226799 12:49871237-49871259 AAGGTTACACAGCTGGAAAGTGG + Intronic
1097401820 12:59136997-59137019 AACCTAACAAAGAGGGAAAATGG - Intergenic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098143162 12:67471306-67471328 AAGTTCACACAGCTAGAAAATGG + Intergenic
1098432665 12:70436843-70436865 AAGATCACACAGATGCCAAAAGG - Intergenic
1098566702 12:71945313-71945335 AAATAAAAACAGATGTAAAAGGG - Intronic
1098841131 12:75479431-75479453 AAATTAAGAGAGATGGAAAATGG - Intergenic
1099294993 12:80819288-80819310 AAATTAACACATTTGAAAAAAGG - Intronic
1099628330 12:85106308-85106330 AAGTTCACACAGCTGTTAAATGG + Intronic
1100068324 12:90679149-90679171 AAGTGAACACAGAGAGAAGATGG - Intergenic
1100137836 12:91575993-91576015 AAGGTAACACAGCTAGCAAAGGG + Intergenic
1100373753 12:93993347-93993369 AAGTTCACACAGTTAGAAAGTGG + Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1101322713 12:103687257-103687279 AAGATCACACAGCTGGTAAATGG + Intronic
1101839731 12:108319362-108319384 AAGATCACACAGCTAGAAAATGG + Intronic
1102851071 12:116245738-116245760 AAATAAACAAAAATGGAAAATGG + Intronic
1103220141 12:119237375-119237397 AAGTTCACAGAGGTGGTAAATGG + Intergenic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1105428150 13:20313492-20313514 AGGATGGCACAGATGGAAAAGGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106939193 13:34758146-34758168 AAGATAACAAAAATGGGAAAAGG - Intergenic
1107872296 13:44758702-44758724 AAGTTAACACTGATTGGAATAGG + Intergenic
1107914359 13:45134170-45134192 AAAATCACACAGATTGAAAAGGG - Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108008197 13:45974375-45974397 AAATTAATACAGAGGGAAACTGG + Intronic
1108258755 13:48636292-48636314 AACATCACACAGATGGAAAGTGG - Intergenic
1110053282 13:70932772-70932794 AAGTTAATACTGAAGGCAAATGG - Intergenic
1110596147 13:77322686-77322708 AATTTAACACAAGTAGAAAAAGG + Intronic
1111037717 13:82701220-82701242 AAGCTAAAAAAGCTGGAAAAAGG + Intergenic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1111397575 13:87685081-87685103 AAGGTCAGACACATGGAAAATGG + Exonic
1111607426 13:90559444-90559466 AAGATTACACAGCTGGAAAGAGG + Intergenic
1112609537 13:100942740-100942762 AAGATCACACAGCTAGAAAATGG - Intergenic
1114793138 14:25681535-25681557 AAGGTCACATAGATGGAAAGAGG - Intergenic
1115337696 14:32258346-32258368 AAATTTACAAAGCTGGAAAATGG + Intergenic
1116215674 14:42014150-42014172 AAGATAAAAGAGATGGACAAGGG - Intergenic
1116398587 14:44476768-44476790 AAATTAAGAAAGATGGAAGATGG - Intergenic
1117346013 14:54833493-54833515 AAGTTAACACACATGATACATGG - Intergenic
1117780490 14:59226737-59226759 AAGTTTAGAAAGATGGAAAAGGG + Intronic
1118258199 14:64223515-64223537 AAGTCCACACAGCTAGAAAAAGG - Intronic
1118422303 14:65620245-65620267 CAGTCAACACAGTTGAAAAATGG - Intronic
1118661529 14:68018880-68018902 AAGTTTTCACAGCTGGTAAATGG - Intronic
1118788639 14:69068161-69068183 AATATAACAGAGATGAAAAAAGG - Intronic
1118913786 14:70083752-70083774 AAGTTCACATAGATGGTAAATGG + Intronic
1119660622 14:76448779-76448801 AAGTTTACACATATGCAAACTGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120147700 14:80997449-80997471 AAGGTCACATAGATGAAAAATGG + Intronic
1120278810 14:82412875-82412897 AAGTTAACAAAAATTGACAACGG - Intergenic
1120529410 14:85614179-85614201 AAGTTAACACAACTGGGAAGTGG + Intronic
1120599112 14:86478821-86478843 AAGTTAACATACTTGGAAATGGG - Intergenic
1122337398 14:101002849-101002871 GAGCTCACCCAGATGGAAAACGG - Intergenic
1122481043 14:102047746-102047768 AAGAAATCACAGAGGGAAAAGGG - Intronic
1122729622 14:103786421-103786443 CAGTTCACAGAGAAGGAAAATGG - Intronic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1124650985 15:31473836-31473858 GAGTTAGCACAGATGGGAGAAGG - Intergenic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1125284261 15:38074917-38074939 AAGGTCACACAGATGTTAAATGG + Intergenic
1125730005 15:41887798-41887820 AAGTGGACACAGATGTAGAAAGG - Intronic
1126012979 15:44320948-44320970 AAATTTAAACAGATGGGAAAGGG - Intronic
1126431775 15:48593427-48593449 CAGTTAACAGGGATGCAAAAAGG - Intronic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1127247129 15:57189397-57189419 AAGATAACCCAGTTAGAAAATGG + Intronic
1127601348 15:60540467-60540489 AAGTTAAGACAGCTGCAAAGTGG - Intronic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128824515 15:70699793-70699815 AAGTTAGCACAGAAGGGAGAAGG - Intronic
1129494404 15:75964227-75964249 AAATAAACACAGAAGGAAAGGGG + Intronic
1130223459 15:82040753-82040775 AAATTAACACAAAAGGAAGAAGG + Intergenic
1130264232 15:82384764-82384786 AAGTTAACATAGAATGACAAAGG + Intergenic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1132787437 16:1665586-1665608 AAGTCAACACTGGTAGAAAAGGG - Intronic
1133360884 16:5172993-5173015 TATTAAACACAGCTGGAAAATGG - Intergenic
1133901354 16:9978304-9978326 AAGTTCACACAGATAGGAAGAGG - Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134777108 16:16862943-16862965 AAGTTAACTGAGATTGAAAACGG + Intergenic
1134819536 16:17235465-17235487 AAGGTCACACAGCTGGAAAGAGG + Intronic
1135051280 16:19195032-19195054 AAGTTCACACAGCTGGGAAATGG - Intronic
1135792474 16:25409908-25409930 AAGGTCACACAGGTGGCAAATGG - Intergenic
1136470391 16:30475666-30475688 AAGTTCCCACAGATGGTCAAAGG + Intronic
1136694674 16:32066939-32066961 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136795176 16:33010201-33010223 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136874740 16:33844181-33844203 AAGTCTACAGAGATGGAAAATGG + Intergenic
1140161468 16:72499349-72499371 ATGTTCACAAAAATGGAAAAGGG - Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140476880 16:75243453-75243475 AAGTTAAAACAAATAGCAAATGG + Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141047754 16:80731993-80732015 AAGTCAGCACAGATTGAAACAGG + Intronic
1141285341 16:82666763-82666785 AAGGTCACACAGATGGAAGCTGG + Intronic
1203097431 16_KI270728v1_random:1271861-1271883 AAGTCTACAGAGATGGAAAATGG - Intergenic
1142844543 17:2662744-2662766 AAATTCACACAGAAGTAAAATGG - Intronic
1144286085 17:13776023-13776045 AAGTTCACACAGCTTCAAAATGG + Intergenic
1144406881 17:14960420-14960442 AAGATCAAACACATGGAAAAAGG - Intergenic
1144520568 17:15949945-15949967 AAGGTAACACTGATGCAGAAGGG - Intronic
1146541584 17:33700580-33700602 AAGTAAAGACAGATGCGAAAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146650774 17:34604937-34604959 AAGGTCACACAGCTGGAAAGAGG + Intronic
1146744321 17:35314263-35314285 AAGGCAACAGAGATCGAAAAGGG + Intergenic
1147929316 17:43967745-43967767 AAGTAAACACAGCGGGGAAACGG + Intronic
1148444975 17:47732197-47732219 TAGTTAACATAAAAGGAAAATGG + Intergenic
1148923185 17:51058429-51058451 AAAGTCACACAGATAGAAAATGG + Intronic
1149024051 17:52003706-52003728 AAGTTCACACAAAAGGGAAATGG + Intronic
1149915617 17:60606072-60606094 AGGTTACCAGAGATGGGAAAGGG - Intronic
1150901678 17:69285027-69285049 AAGGTAACACAGGTAGAAAGTGG - Intronic
1150921257 17:69486006-69486028 AAGTTTACATAAATGGAAATAGG - Intronic
1151069124 17:71188158-71188180 AAATTTACTCAGATGCAAAATGG - Intergenic
1151098768 17:71531551-71531573 AATTTAAAACAGATGTACAATGG - Intergenic
1151735507 17:75937632-75937654 CAGTGAACACAGGTGGAAATTGG + Intronic
1153329591 18:3860175-3860197 AAGTTAATACAGATGCTGAAGGG + Intronic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1155814154 18:30283435-30283457 AAATTCAAACAGATGGTAAATGG + Intergenic
1155882903 18:31172103-31172125 CAGTTAACACAAATGTAAAGTGG - Intergenic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1156524406 18:37753036-37753058 AAGTTCACACAGCTAGTAAATGG + Intergenic
1156630161 18:38957892-38957914 AATTTTACAGAGATGGAAAGTGG - Intergenic
1156766307 18:40660717-40660739 AAGTTTACTAAGATAGAAAATGG + Intergenic
1156986048 18:43352792-43352814 AGGTTAGCACATATGGGAAATGG - Intergenic
1157889173 18:51398238-51398260 AAGATTACACAGATGGAAACTGG - Intergenic
1157942419 18:51943594-51943616 AAGTACACAAAAATGGAAAATGG - Intergenic
1159237895 18:65700948-65700970 AATTTATCACAGTTGTAAAAAGG + Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159672211 18:71235717-71235739 AAGTTAGGAAAGATGGAAAATGG + Intergenic
1160038773 18:75324650-75324672 AAGTAAACCCAGAAGGAAAGGGG - Intergenic
1161264309 19:3357176-3357198 AAGTTGACCCCTATGGAAAAAGG + Intergenic
1161863223 19:6814732-6814754 AAGACAAGACAGAGGGAAAAAGG - Intronic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1163217259 19:15890054-15890076 GAGTTAACACTGATGCAAAGAGG - Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164666223 19:30039638-30039660 AATTAAACACAGAAAGAAAAAGG - Intergenic
1165203946 19:34168060-34168082 AAATTGTTACAGATGGAAAAAGG - Intergenic
1168079125 19:53996358-53996380 AAGTTAAGAAAGACAGAAAAAGG - Intronic
1168571455 19:57474451-57474473 AAATTGACACAGGTGGAAGAGGG + Intronic
925530987 2:4862243-4862265 AAGTTGACTCATTTGGAAAAAGG + Intergenic
926266499 2:11327207-11327229 AAGTTTAAAGTGATGGAAAATGG + Intronic
926394288 2:12425307-12425329 AAGGTAACACAGATTTTAAATGG + Intergenic
927323920 2:21781088-21781110 AAGTTAACACAGGTGGACACAGG + Intergenic
927409707 2:22810444-22810466 AAGTAAACACACAAGGAAGAAGG - Intergenic
928238476 2:29565855-29565877 AAATTAACACAGTTAAAAAAGGG + Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
929899532 2:45988889-45988911 AAAATAAAACAGGTGGAAAAGGG - Intronic
930253141 2:49058735-49058757 AATTTAACTCAAGTGGAAAAAGG + Intronic
931172228 2:59815427-59815449 AATTTATCACAAATGGAAAGGGG - Intergenic
931433871 2:62230959-62230981 AAGTGTACACAGATGGGCAAAGG - Intergenic
931476512 2:62593076-62593098 AAGTTCACACGGATGGTAAGTGG + Intergenic
932075347 2:68657133-68657155 AAGGTACCACAGAAGGACAAAGG - Intergenic
932283480 2:70514264-70514286 ATATTAACACACATGGAGAAAGG + Intronic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
933369240 2:81394251-81394273 CAGTGATCACAGATGAAAAAGGG - Intergenic
933442554 2:82331847-82331869 AAATTTACACAGATGGTAACTGG - Intergenic
933463867 2:82625144-82625166 ATGTTACCATACATGGAAAATGG + Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
935668655 2:105536451-105536473 AAACTAACACAGATAGGAAAGGG + Intergenic
936616344 2:114051568-114051590 AAGGTTACACAGTTGGTAAACGG + Intergenic
936963237 2:118099019-118099041 AAGTTGCCAGAGATGGAAAATGG + Intronic
937426885 2:121807245-121807267 AAGGTCACACAGTTAGAAAATGG + Intergenic
937509205 2:122574568-122574590 AATTTTACCCTGATGGAAAATGG + Intergenic
937950062 2:127378125-127378147 AAGATGACAGACATGGAAAATGG + Intronic
939575529 2:143890606-143890628 AAGTAATAACAGATGGGAAAAGG + Intergenic
939921554 2:148121103-148121125 AATTTAACACAGCTAGAAAACGG - Intronic
940025754 2:149205467-149205489 AAGTTACAATAAATGGAAAAGGG - Intronic
940062085 2:149583456-149583478 TATTTGACACAGATGGTAAAGGG + Intronic
941021719 2:160414058-160414080 AATGTGACACAGATGGTAAATGG - Intronic
941183416 2:162288980-162289002 TAGTTGCCTCAGATGGAAAAAGG - Intronic
941266972 2:163374533-163374555 AAGCCAACACAGATGGAGTAGGG + Intergenic
942204435 2:173605364-173605386 AAGTTAAGATAGAAGGAACAGGG - Intergenic
942211856 2:173678991-173679013 TAGTTATCTCATATGGAAAATGG - Intergenic
942335598 2:174881560-174881582 AAGCTAACAGAGAAGGAGAAAGG - Intronic
942635362 2:177998378-177998400 TATTTAACATGGATGGAAAAGGG - Intronic
942913411 2:181273648-181273670 AAGGTAAGAAAGAGGGAAAATGG - Intergenic
943003855 2:182364302-182364324 AAATTAACACACATGGGATAGGG - Intronic
943877288 2:193085910-193085932 ATATTAACAGAGATGGAATATGG + Intergenic
943886310 2:193221285-193221307 TAGATACCACAGAGGGAAAATGG - Intergenic
944378214 2:199073939-199073961 AAGCCAACAAAGATGCAAAAAGG + Intergenic
944415575 2:199476176-199476198 AAGTTTACACAGCTAGTAAATGG - Intergenic
944538679 2:200736483-200736505 TATTTGACACAGAGGGAAAAGGG - Intergenic
944654152 2:201861139-201861161 AAGTTACCCCAGATAGTAAAAGG - Intronic
944988005 2:205201329-205201351 AGGATAACAGTGATGGAAAACGG + Intronic
945658046 2:212649767-212649789 AAGGTGACAAAGATGGAAGAAGG + Intergenic
946443499 2:219717535-219717557 AAATTAATAAGGATGGAAAAGGG + Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946857344 2:223964543-223964565 AAGTTACCACATGGGGAAAATGG + Intronic
946868530 2:224064668-224064690 AAGTTCACACAGTTGGTCAACGG - Intergenic
947126552 2:226874595-226874617 TATTTAACACAGATAGAAAAAGG - Intronic
947227874 2:227857620-227857642 AAGTTAGAAAAGATGGAAACAGG + Intergenic
947354370 2:229276758-229276780 AAGTCAGCTCAGATGGAGAAAGG - Intergenic
948013299 2:234667687-234667709 AAGCTCACACAGCTGGGAAATGG + Intergenic
948316773 2:237033221-237033243 AAGTTAACAAAGTAGGAACAGGG - Intergenic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
1170479733 20:16754042-16754064 AAGTATACACAGCTAGAAAACGG - Intronic
1170684375 20:18555750-18555772 ATGTTAACACTAAGGGAAAATGG - Intronic
1170688803 20:18593456-18593478 AAGGTAACATAGATGAAATATGG + Intronic
1170803284 20:19608010-19608032 AAGTGAACAGAGATGAAAAAGGG - Intronic
1171258837 20:23713059-23713081 AAATTTACACAGATTGTAAATGG + Intergenic
1171453727 20:25254499-25254521 AAGTGAACACAGATTTAGAAAGG + Intronic
1173818679 20:46006980-46007002 AAGGTCACATAGCTGGAAAATGG + Intergenic
1173979239 20:47210469-47210491 AAGTTAATACAAATATAAAAAGG + Exonic
1174345256 20:49924347-49924369 AAGGTCACACAGATGGAAAGCGG - Intergenic
1174884629 20:54319681-54319703 CAGTTAACCCAGATGAAAACAGG + Intergenic
1175159077 20:56994637-56994659 AAGGTCACACAGCTGGAAAAAGG - Intergenic
1175248656 20:57596249-57596271 AAGGTCACACAGCTAGAAAATGG + Intergenic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1176924854 21:14735957-14735979 AATTTAAGAAAAATGGAAAATGG - Intergenic
1177353734 21:19979922-19979944 AGGTTAACACAGTTAGAATAGGG - Intergenic
1177836231 21:26188952-26188974 AAGCTAACACAGAGGGGAAAAGG + Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1177891456 21:26808863-26808885 AATTTACCTCAGGTGGAAAAGGG - Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1178769842 21:35493009-35493031 AAGAAAACACTGATAGAAAATGG + Intronic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1179333999 21:40432983-40433005 AATTTGAAACAGATAGAAAATGG - Intronic
1180819792 22:18818626-18818648 CAATTAAAACAGATGCAAAAGGG - Intergenic
1181206015 22:21253077-21253099 CAATTAAAACAGATGCAAAAGGG - Intergenic
1181403978 22:22668846-22668868 AAGGTGACACAGATGGCAAGGGG - Intergenic
1181416419 22:22762613-22762635 AAGATGAGACAGATGAAAAATGG - Intronic
1181949879 22:26546248-26546270 ATCTAAACCCAGATGGAAAAGGG + Intronic
1182132663 22:27868648-27868670 GAGTTAACACAGAAGACAAATGG + Intronic
1182249166 22:28985913-28985935 AAGCTGACAAAGATGAAAAATGG - Intronic
1182318233 22:29462025-29462047 AAGGTAACACAGCTGATAAATGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182673514 22:32018213-32018235 GAGTCAACACAGTTGGGAAAAGG + Intergenic
1182857582 22:33531568-33531590 AAGATCACACAGCTAGAAAATGG + Intronic
1184064498 22:42109743-42109765 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1184545742 22:45165905-45165927 AAGTTCTCACAGCTAGAAAATGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1203220906 22_KI270731v1_random:42338-42360 CAATTAAAACAGATGCAAAAGGG + Intergenic
1203269919 22_KI270734v1_random:44483-44505 CAATTAAAACAGATGCAAAAGGG - Intergenic
949473029 3:4416597-4416619 AAGGTTACACAGCTGGAAAGCGG - Intronic
949741254 3:7237210-7237232 GAGGTAACAGAAATGGAAAAAGG - Intronic
950206919 3:11087993-11088015 AAGTTAACACAGCCAGGAAATGG + Intergenic
950983748 3:17337514-17337536 AAGTTAACACAGCGGAAATATGG + Intronic
951253462 3:20421132-20421154 AAGTTCACACAGCTAGAAAGTGG + Intergenic
951303168 3:21023471-21023493 AAGGCAAGACACATGGAAAAGGG + Intergenic
951410220 3:22354198-22354220 AAGATTACTCAGTTGGAAAATGG - Intronic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951645888 3:24890876-24890898 AAGATCACACAGCTGGTAAATGG - Intergenic
951714917 3:25631485-25631507 ATGTTAACCCAGACAGAAAAAGG + Intronic
952916597 3:38250379-38250401 AAGGTCACACAGCTGGAAAGAGG + Intronic
953135716 3:40180149-40180171 AAGCTAACACACATGTAAAGTGG - Intronic
953154892 3:40360786-40360808 AAGTAAACAGAGAAGGAAAAAGG - Intergenic
953659693 3:44883118-44883140 AAGCAATCACAGCTGGAAAAGGG - Intronic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
956055367 3:65293020-65293042 AAAATAACACAGATAGAGAAAGG + Intergenic
956825830 3:72996550-72996572 AAGTTCACACAGAGAGGAAATGG + Intronic
956856129 3:73276573-73276595 AAGGTCACACAGCTGGAAAACGG + Intergenic
956958093 3:74364574-74364596 GAGAGAACACAGATAGAAAATGG - Exonic
957087025 3:75690320-75690342 CAATTCACACAGATGAAAAATGG + Intergenic
957556634 3:81770477-81770499 AAGTTAATACATTTGGGAAAGGG - Intergenic
957618570 3:82566117-82566139 ATGTTAAAACAGATGGATACTGG + Intergenic
959048501 3:101501097-101501119 AAATCATCACAGAAGGAAAAAGG - Exonic
959241629 3:103803546-103803568 AAGTTAAAACACTTAGAAAAAGG + Intergenic
959669945 3:108965079-108965101 AACTTAACTCAGCTGGAATAAGG + Intronic
959840369 3:110968023-110968045 AAGAGAACACAAAAGGAAAATGG - Intergenic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960311493 3:116121714-116121736 AAGGTAACACTGATAGTAAATGG + Intronic
960562427 3:119099555-119099577 TACTTCACATAGATGGAAAAAGG + Intronic
961092966 3:124131326-124131348 AAGTAAACACAGTTGGTAACTGG - Intronic
961574215 3:127822077-127822099 AAATAAACACAGATGGGAAGGGG - Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
964455623 3:156862596-156862618 TAGTTAACAAACATAGAAAAAGG - Intronic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
965095752 3:164222995-164223017 AGGCTAAAACAGATAGAAAAAGG - Intergenic
965214014 3:165836704-165836726 AAGTGAACACAAAGGGCAAAGGG + Intronic
965323116 3:167271490-167271512 AAGAAAACTCAGAAGGAAAATGG + Intronic
966048091 3:175577835-175577857 AGGTTAACACAGAAAGCAAAGGG - Intronic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
967734575 3:192938758-192938780 AAGTTAACACAGCATGGAAAGGG + Intergenic
967840196 3:193998990-193999012 AAGCTCACACAGAGGGAAGAGGG + Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
968683571 4:1939520-1939542 AAGTTAAGCCAGAAGGACAAAGG + Intronic
968708902 4:2098029-2098051 AGCTTAACACAGCAGGAAAAGGG - Intronic
969996083 4:11314790-11314812 AAGGTAACACAGATGTTCAATGG + Intergenic
970052058 4:11925569-11925591 AAGGTCACACAGATAGAAGATGG + Intergenic
970610191 4:17718052-17718074 AAGTTCACACATCTAGAAAAAGG - Intronic
970845201 4:20529473-20529495 TAGTTTACAGAGATTGAAAATGG - Intronic
970885244 4:20980538-20980560 AATTAGACACAGATAGAAAAGGG - Intronic
971123860 4:23731111-23731133 GAGTTTACACAGCTGGGAAATGG - Intergenic
971340151 4:25760939-25760961 AAGGTTACACAGCTGGAAAGTGG + Intronic
971650185 4:29261760-29261782 AAGTTAAAATATGTGGAAAAAGG + Intergenic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972697542 4:41462808-41462830 AAAGTAACACAGCTGGCAAAAGG + Intronic
972961822 4:44462277-44462299 AAGTTCACACAGCTAGCAAATGG + Intergenic
972978948 4:44671999-44672021 AAACTAATACAGATGGCAAAAGG + Intronic
973156322 4:46958177-46958199 AATATAACACAGACAGAAAATGG - Intronic
973580217 4:52336498-52336520 AAAGTAACACAGTTGGGAAATGG - Intergenic
973946296 4:55959722-55959744 AAGTTAGCAATGATGGAAAGTGG + Exonic
974154514 4:58054094-58054116 AAGTAAAAACAGAAGAAAAATGG - Intergenic
974225391 4:59036280-59036302 CAGTTAACACAGAAAGAAAAGGG - Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
975299017 4:72767505-72767527 AAGGTCACACAGATGGAAAGTGG - Intergenic
975465761 4:74707794-74707816 AAGTTATCACAGAGAGAAGAAGG + Intergenic
975470136 4:74756526-74756548 AAGATCACACAGATAGAAAGTGG + Intronic
975476898 4:74833854-74833876 AAATCAACACAGCTGGAAAGTGG - Intergenic
975495931 4:75035934-75035956 TAATTAAACCAGATGGAAAAAGG - Intronic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
976261567 4:83150182-83150204 AAGTTTGCATAGATGTAAAAGGG + Intergenic
976587653 4:86816665-86816687 AAGTCAACATAGATGGGAGAGGG + Intergenic
976890554 4:90041311-90041333 ACGGTCACAGAGATGGAAAATGG - Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977661978 4:99599121-99599143 AAGTTAACAGGTATGCAAAAAGG + Intronic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
979760859 4:124402571-124402593 CAGCTAAGTCAGATGGAAAAGGG - Intergenic
980383293 4:132055565-132055587 AAGTAAACATAGGTGGCAAATGG - Intergenic
980492059 4:133541107-133541129 AAGCTATCTCAGATGCAAAAGGG - Intergenic
980673272 4:136038771-136038793 AAGTTAAAACACATGGTTAATGG - Intergenic
980789623 4:137603256-137603278 AAGATTACACAGCTGGAAAGTGG - Intergenic
981582733 4:146266799-146266821 AAGGTCACACAGGTGGTAAATGG - Intronic
981844587 4:149153177-149153199 AAGATAAAAAAGAAGGAAAATGG + Intergenic
981898549 4:149834488-149834510 AAGGTCACACAGATAGACAAGGG - Intergenic
982186529 4:152807592-152807614 AAGAAAACACAAATGAAAAATGG - Intronic
982334559 4:154219458-154219480 AAGTTAATACAGAAGAATAAAGG - Intergenic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
982996136 4:162348766-162348788 AAGGTCATACAGATGGTAAATGG + Intergenic
983145887 4:164214799-164214821 AAGTTAAGACAGGAGGGAAATGG - Intronic
983235047 4:165169965-165169987 AAGGTAACACAGCTGGAAAGTGG - Intronic
984171108 4:176360224-176360246 AAGGCAACACAAATAGAAAAGGG - Intergenic
984649960 4:182260399-182260421 TAGTTAACACAGTAGGAAAAAGG - Intronic
985893434 5:2734254-2734276 AAGTGTTCACAGATAGAAAAGGG - Intergenic
987557605 5:19474619-19474641 AAGATCACACAGATGGCAAGTGG + Intronic
987653992 5:20782534-20782556 AGATGAACGCAGATGGAAAAGGG + Intergenic
987927310 5:24359141-24359163 AAGCCAACAGATATGGAAAATGG - Intergenic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988590268 5:32542696-32542718 AAGCAACCACAGATGTAAAATGG + Intronic
988741583 5:34078958-34078980 AGATGAACGCAGATGGAAAAGGG - Intronic
988823380 5:34910341-34910363 AAGTTAACCAAAATGGAAATTGG - Intronic
988941076 5:36148706-36148728 AAGTTAACAGAGCTGGTGAATGG + Intronic
989602007 5:43209100-43209122 AAATAAAAACAGAGGGAAAATGG + Intronic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
990763967 5:59161758-59161780 AAGTAAATACAGGGGGAAAACGG - Intronic
990983342 5:61620743-61620765 AAGTTAGCCAAGAAGGAAAAGGG - Intergenic
991243680 5:64486845-64486867 AAGTTAACATTGAAGGAAGATGG - Intergenic
991557881 5:67915808-67915830 CACATAAAACAGATGGAAAATGG - Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992960118 5:81949814-81949836 AAGTAAACAAGGATTGAAAATGG + Intergenic
993289184 5:86042485-86042507 AAGTTAACACAGAAGGGCAAAGG - Intergenic
993423342 5:87730174-87730196 AAATTAAAGCAGATGGGAAAGGG - Intergenic
993482207 5:88437994-88438016 AAAATAAAACAGAAGGAAAAGGG - Intergenic
993643596 5:90435868-90435890 AAGTTTACACACATATAAAATGG + Intergenic
995615930 5:113964387-113964409 AGGTGAACATTGATGGAAAATGG - Intergenic
995642376 5:114271815-114271837 AATTTCACACAGAATGAAAATGG - Intergenic
995815535 5:116163859-116163881 AATTTCACACAAATGGAAACTGG - Intronic
996193725 5:120577894-120577916 AAGTTCACACTGATAGAAAGTGG + Intronic
997736810 5:136218935-136218957 AAGGTCACACAGCTGGAAAGTGG + Intronic
998331772 5:141333998-141334020 AAGTTAACACACATTAAAATAGG - Intronic
998376296 5:141692950-141692972 AAGGTCACACAGCTAGAAAATGG - Intergenic
998414471 5:141936260-141936282 GAGTTAACACAGCTGGTAAGTGG + Intronic
998559490 5:143157897-143157919 AAGTTTACACAGTTAGGAAATGG - Intronic
998674315 5:144390176-144390198 AAATTATCACATATAGAAAAGGG - Intronic
999300542 5:150487411-150487433 AAGGTCACACAGATAGAAAGTGG + Intronic
999816477 5:155181904-155181926 AAGTTAAAACAGTTGAGAAATGG + Intergenic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
999991175 5:157051510-157051532 AAATTTACACAGATAGAAAGTGG - Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1001151405 5:169231433-169231455 AAGTTTACACAAATGGAATCAGG + Intronic
1001221896 5:169907672-169907694 AAGATCACACAGCTGGAAAATGG + Intronic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1001535721 5:172496656-172496678 AAGGTCACAGAGGTGGAAAAAGG + Intergenic
1002396639 5:178961381-178961403 AAGCTAATACAGAGTGAAAATGG - Intronic
1002606478 5:180385998-180386020 AATTTAACCCAAATGGCAAAAGG + Intergenic
1002681119 5:180965565-180965587 AAAATAACACAGTTGTAAAACGG + Intergenic
1002891520 6:1336711-1336733 AGGTCAAGAAAGATGGAAAATGG + Intergenic
1003358846 6:5404049-5404071 AAGTTTACACAGATAGTAAGCGG + Intronic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1004139699 6:13005891-13005913 AAGTTCTCACACTTGGAAAAAGG + Intronic
1004292998 6:14385361-14385383 AAATTAAGACACATAGAAAATGG - Intergenic
1004798724 6:19120221-19120243 AAGTTAACAGAAGAGGAAAATGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1006535860 6:34698127-34698149 AAGATTACACAGCTGGAAAGTGG + Intergenic
1006658937 6:35622835-35622857 AAGTTTACACAGATAGTAAAGGG - Intronic
1007214946 6:40229478-40229500 TAGTTAACACAATGGGAAAAAGG - Intergenic
1007237640 6:40402300-40402322 AAGCTCACACAGCTGGAAAGTGG + Intronic
1007912550 6:45530417-45530439 AGGTTAACACTGAGGGAAACGGG + Intronic
1008680527 6:53867091-53867113 AAGTTTACACAGCTGGTAAGTGG - Intronic
1009585756 6:65599508-65599530 AAGTTCACAAAGATGGATCAAGG - Intronic
1009952963 6:70417812-70417834 AAGATAAAAGAGATGGTAAAGGG - Intronic
1010260518 6:73810468-73810490 CAGTTACCACAGATGAAAAGTGG - Intronic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1010654165 6:78492181-78492203 AAGATAATACAGCTTGAAAATGG + Intergenic
1010701103 6:79048355-79048377 AAGTTCACAAAGAAAGAAAAAGG + Intronic
1010876341 6:81111980-81112002 AACTTATCACAGATAAAAAAGGG - Intergenic
1010929330 6:81781608-81781630 AAATTAAAACATTTGGAAAAAGG + Intergenic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011140322 6:84147698-84147720 AAGTCTACACATTTGGAAAAAGG + Intronic
1011559609 6:88601224-88601246 AACTTAAGAGGGATGGAAAATGG + Intergenic
1011950435 6:92958149-92958171 ATGTTAACATAGAGAGAAAATGG + Intergenic
1012206589 6:96468522-96468544 AAGGTAACACAGCTGGCAAGTGG - Intergenic
1012422131 6:99077234-99077256 AAGGGAACACAGATGATAAATGG + Intergenic
1012493476 6:99808986-99809008 CAGATAACACGGATGGACAATGG + Intergenic
1012536944 6:100310125-100310147 AATTTGACACAGATATAAAATGG + Intergenic
1013110753 6:107062982-107063004 AAGTTCACACAACTGGAAATTGG - Intergenic
1013464254 6:110403230-110403252 AAGTTAAAACATGTGGAAAAAGG - Intronic
1014497297 6:122141455-122141477 AAGGACACACAGATAGAAAAAGG - Intergenic
1015316781 6:131825881-131825903 AAGTTAATAAAGATGAAAAATGG - Intronic
1015841899 6:137486391-137486413 AATTCAACACAGAAGGATAAGGG + Intergenic
1016596145 6:145803645-145803667 AGGGTATCACAGAAGGAAAATGG + Intronic
1017027521 6:150194276-150194298 AAGGTAACAGAAATGGAAGAGGG - Intronic
1017035841 6:150266476-150266498 AAGGTGGCACAGCTGGAAAATGG - Intergenic
1018724532 6:166600792-166600814 AAGTGAATAGAAATGGAAAATGG + Intronic
1019425105 7:971379-971401 ATTTTAGCACAGAAGGAAAAAGG + Intronic
1020708288 7:11572877-11572899 AAGTTACTACACATGAAAAAAGG - Intronic
1020774373 7:12434862-12434884 TAGTAAACCCAGATGGAATATGG - Intergenic
1021249139 7:18303183-18303205 AAGTTTTCAGAGATGGCAAATGG + Intronic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021858529 7:24882050-24882072 ATGTTACCACATTTGGAAAAAGG - Intronic
1022056274 7:26738155-26738177 AAGGTCACAGAGTTGGAAAATGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022604041 7:31790807-31790829 AAGACGACAAAGATGGAAAAAGG + Intronic
1022837844 7:34134020-34134042 AAGATAAAAAAGATTGAAAAAGG + Intronic
1023250118 7:38250047-38250069 AAGTTACAAAGGATGGAAAAGGG - Intergenic
1023251425 7:38266153-38266175 AAGTTACAAAGGATGGAAAAGGG - Intergenic
1024829628 7:53435036-53435058 AAGTTAATACCAATGGCAAAGGG - Intergenic
1026520178 7:71110585-71110607 AAGTTATCACAGATTAAAATGGG + Intergenic
1027385102 7:77652258-77652280 TAGTTAACTCAGTTGAAAAAGGG + Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1028202214 7:87975044-87975066 ATGTTACCTCACATGGAAAAAGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028796988 7:94914026-94914048 AAAGAAACACAGATAGAAAATGG - Intronic
1028990319 7:97042384-97042406 AAGTTAGCAAATATGGCAAAAGG - Intergenic
1030268441 7:107645246-107645268 AAGGTCACTCAGATAGAAAATGG + Intergenic
1030437405 7:109541057-109541079 AAGTTCAGACATATGTAAAAAGG - Intergenic
1030585791 7:111417503-111417525 GAGTTAGCACAGTTGGGAAAGGG - Intronic
1031057515 7:117009810-117009832 AAGTAACCACAGCTGGAAAAAGG - Intronic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1032203855 7:129844624-129844646 AAGTTAAGACAGGCGGAAATGGG - Intronic
1032216806 7:129963794-129963816 AAGGTCACACAGACGGTAAATGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032510282 7:132466754-132466776 AAGTTAAAAAAGGAGGAAAATGG - Intronic
1032850420 7:135790335-135790357 AAGTTAACACAGTTAGGAAAGGG - Intergenic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1033538132 7:142331110-142331132 TAGTTAACAAAGATGGGAAGTGG + Intergenic
1033869562 7:145734626-145734648 AAGTTAATAACGATGGATAAAGG - Intergenic
1034040223 7:147870069-147870091 AAGGTAACACAGCTAGTAAATGG + Intronic
1034308425 7:150065713-150065735 AAGCTAAAACATATGCAAAATGG - Intergenic
1034798428 7:154034962-154034984 AAGCTAAAACATATGCAAAATGG + Intronic
1035143151 7:156784782-156784804 AACTCTACACAGATGTAAAAGGG + Intronic
1035823667 8:2621401-2621423 AAGTTAACACATATAAAATAAGG - Intergenic
1036372551 8:8173634-8173656 TCTTTAACACAGATGAAAAATGG + Intergenic
1036878352 8:12492007-12492029 TCTTTAACACAGATGAAAAATGG - Intergenic
1036949662 8:13129036-13129058 AAGGTCCCACAGAAGGAAAAGGG + Intronic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1037274994 8:17168588-17168610 AAGATGACAAAGTTGGAAAATGG - Intronic
1037378528 8:18259168-18259190 AAGGTCACATAGATGGAAACTGG + Intergenic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1038331903 8:26615652-26615674 AAGAAAACACAGATGGCAATTGG + Intronic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038761405 8:30386179-30386201 AGGTGAACACAGAAGGTAAACGG + Intronic
1038779685 8:30559071-30559093 AGTTTAACAAAGATGGACAAAGG - Intronic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1039980945 8:42409663-42409685 AAAGTAAAACAAATGGAAAAGGG + Intergenic
1040844867 8:51826653-51826675 TTGTTAACAAAGATTGAAAACGG + Intronic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041943181 8:63410888-63410910 AAGGTAATACAGCTGGTAAATGG - Intergenic
1043099800 8:76028950-76028972 AAGTTCACAAAGAAGGGAAATGG - Intergenic
1044108700 8:88244666-88244688 AAATTCACACAGTTGGTAAAAGG + Intronic
1044214552 8:89593654-89593676 AAGTTCACACAGCTTGAAAGTGG + Intergenic
1044400070 8:91760054-91760076 AAGTTCACACAGCTTGAAATTGG + Intergenic
1044495085 8:92867893-92867915 AAGTGAGCACAGATGTGAAATGG + Intergenic
1044554862 8:93552228-93552250 AAGTTTACACAGTTAGGAAATGG - Intergenic
1044630206 8:94271209-94271231 AAGTTCCCACAGCTAGAAAATGG + Intergenic
1044828192 8:96219205-96219227 ATGTTAACCTACATGGAAAAAGG + Intergenic
1044828344 8:96220245-96220267 ATGTTAACCCACATGGCAAAAGG + Intergenic
1045041970 8:98233834-98233856 ATGTTAACAAAGATACAAAAAGG - Intronic
1045754508 8:105526920-105526942 AAGGTCTCACAGATGGTAAATGG - Intronic
1045844078 8:106613168-106613190 ATGTTCACACAGAGGGAAAGAGG + Intronic
1045993519 8:108337681-108337703 AAGTTAACAAATATGATAAATGG - Intronic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1046897455 8:119488251-119488273 AAGTCCACATTGATGGAAAAAGG - Intergenic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1048660514 8:136595277-136595299 AAGTTCACACAGTTTGAACAGGG - Intergenic
1048819567 8:138368351-138368373 AAGGTCACACAGCTGGAAAGCGG - Intronic
1050056768 9:1663719-1663741 AAGTTTACATAGCTGGAAAGTGG + Intergenic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1050816263 9:9816626-9816648 AGCTTAAAAAAGATGGAAAAAGG + Intronic
1050924512 9:11247213-11247235 AACTTTAACCAGATGGAAAAGGG - Intergenic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1051721085 9:20038202-20038224 AAGCTTACACAGCTGGGAAATGG - Intergenic
1051782095 9:20700321-20700343 AATCTAATAGAGATGGAAAATGG - Intronic
1051850155 9:21497096-21497118 AGATTAAGACAGAGGGAAAATGG + Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052913331 9:33904138-33904160 AAGTGAACACAGAAACAAAAGGG - Intronic
1053436257 9:38076517-38076539 AAGCTTCCACAGAAGGAAAAGGG - Intergenic
1053554883 9:39125718-39125740 AAATTATCAGAGATGAAAAAGGG + Intronic
1053701544 9:40697737-40697759 AATTTAACAAAGAAGGCAAAAGG - Intergenic
1053819000 9:41945974-41945996 AAATTATCAGAGATGAAAAAGGG + Intronic
1054411609 9:64821192-64821214 AATTTAACAAAGAAGGCAAAAGG - Intergenic
1054857900 9:69920870-69920892 AAGGTGACACAGCTGGCAAACGG - Intergenic
1054858801 9:69928843-69928865 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1055833137 9:80406508-80406530 ACTTTAACACAGCTGGAATAAGG + Intergenic
1056536854 9:87535838-87535860 AAGGTGACACAGATGTAAACCGG + Intronic
1056912400 9:90714275-90714297 AAATAAACACAGGGGGAAAATGG + Intergenic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1057986696 9:99724039-99724061 AAGTTGCCACAGAAGAAAAAGGG - Intergenic
1058387506 9:104455606-104455628 AATGTATCTCAGATGGAAAAGGG + Intergenic
1058873844 9:109224975-109224997 AAGCCAAGACAGATGGAAAGAGG - Intronic
1059222398 9:112636956-112636978 AAGTTAACAGAGGAGGAAAATGG - Intronic
1059364531 9:113775848-113775870 AAGTTCACCCAGCTGGAAAGTGG + Intergenic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059882148 9:118703355-118703377 AAGTTATCATAGATAGAAATTGG - Intergenic
1059928711 9:119239634-119239656 AAGGTTTCACAGCTGGAAAAGGG - Intronic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060001674 9:119964359-119964381 ATGTTAAGACAGCAGGAAAATGG - Intergenic
1060153825 9:121305315-121305337 AAGTTCACACAGCTAGTAAAAGG + Intronic
1060246173 9:121948208-121948230 AAGTTAACACAACCGGAACATGG + Intronic
1060746859 9:126142340-126142362 AATTGAACACAGAAGGAAAGAGG - Intergenic
1062742634 9:138187527-138187549 AACTAAAAACAGAGGGAAAAAGG - Intergenic
1186328292 X:8504247-8504269 ATGTTAACATAGCTAGAAAATGG + Intergenic
1186420813 X:9424594-9424616 AAGATAACTCAGAGGGAAAAAGG + Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187411971 X:19059296-19059318 AAATTCACACAGCTGGAAAGTGG - Intronic
1187806232 X:23124140-23124162 AGCTTAACAGAGCTGGAAAAGGG + Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189224392 X:39400476-39400498 TAGTCAACACAAATGGGAAAAGG + Intergenic
1189336770 X:40175226-40175248 AACTTAACACGGAGGCAAAAGGG + Intronic
1190715244 X:53097330-53097352 AACTTAAAACAAATGAAAAAAGG - Intergenic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192268060 X:69553955-69553977 AAATTCACAGAGATAGAAAATGG + Intergenic
1192372024 X:70522186-70522208 AAGGTAACACAGCTGGTAAATGG - Intergenic
1193274980 X:79575515-79575537 AAGGTCACACAGGTAGAAAATGG + Intergenic
1193418303 X:81251525-81251547 AAGAGAACACAGCTAGAAAATGG - Intronic
1194687814 X:96946143-96946165 ACATTAACACAGAAAGAAAAGGG - Intronic
1194691489 X:96991477-96991499 AAGATAACACAGATAATAAATGG + Intronic
1194773543 X:97934461-97934483 AAGATAAACCAGATGGGAAAAGG + Intergenic
1195667546 X:107444672-107444694 AGGTAAACACAGATGGTAATTGG - Intergenic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1195789089 X:108561550-108561572 TACCTAATACAGATGGAAAAAGG - Intronic
1196503619 X:116413950-116413972 AAGATTACACAGCTGGTAAATGG + Intergenic
1197100557 X:122648794-122648816 AAGTTAGCACTGATGGAAAATGG + Intergenic
1197137512 X:123080241-123080263 AAAGTCACACAGCTGGAAAACGG - Intergenic
1197484381 X:127029622-127029644 AAGGTAACACAGCTAGGAAAGGG - Intergenic
1198174560 X:134142695-134142717 AAGGTCACAGAGATGGTAAATGG + Intergenic
1198209200 X:134500782-134500804 AACTTAACAAACAAGGAAAATGG - Intronic
1198692477 X:139299378-139299400 AAGGTAACACAGAGGTAAGAAGG + Intergenic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic
1199500978 X:148505065-148505087 AAGAGACCACAGAGGGAAAACGG - Intronic
1201634612 Y:16108753-16108775 AAAATGACACAGATGGTAAATGG + Intergenic