ID: 928652192

View in Genome Browser
Species Human (GRCh38)
Location 2:33414851-33414873
Sequence GACCCACTTGCAATGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928652192_928652199 29 Left 928652192 2:33414851-33414873 CCTGCCACCATTGCAAGTGGGTC No data
Right 928652199 2:33414903-33414925 TAGCATGTAGGGATCGAATTAGG No data
928652192_928652196 2 Left 928652192 2:33414851-33414873 CCTGCCACCATTGCAAGTGGGTC No data
Right 928652196 2:33414876-33414898 CTGGAAAGCAGACTGTGAAATGG No data
928652192_928652197 17 Left 928652192 2:33414851-33414873 CCTGCCACCATTGCAAGTGGGTC No data
Right 928652197 2:33414891-33414913 TGAAATGGAGATTAGCATGTAGG No data
928652192_928652200 30 Left 928652192 2:33414851-33414873 CCTGCCACCATTGCAAGTGGGTC No data
Right 928652200 2:33414904-33414926 AGCATGTAGGGATCGAATTAGGG No data
928652192_928652198 18 Left 928652192 2:33414851-33414873 CCTGCCACCATTGCAAGTGGGTC No data
Right 928652198 2:33414892-33414914 GAAATGGAGATTAGCATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928652192 Original CRISPR GACCCACTTGCAATGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr