ID: 928654855

View in Genome Browser
Species Human (GRCh38)
Location 2:33439948-33439970
Sequence TTCTCAGATGTGTCTCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928654855_928654858 7 Left 928654855 2:33439948-33439970 CCCAATGGAGACACATCTGAGAA 0: 1
1: 0
2: 1
3: 26
4: 251
Right 928654858 2:33439978-33440000 ACGCGTTTTGCAAACTAATTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
928654855_928654859 12 Left 928654855 2:33439948-33439970 CCCAATGGAGACACATCTGAGAA 0: 1
1: 0
2: 1
3: 26
4: 251
Right 928654859 2:33439983-33440005 TTTTGCAAACTAATTGGGTATGG 0: 1
1: 0
2: 1
3: 9
4: 216
928654855_928654857 6 Left 928654855 2:33439948-33439970 CCCAATGGAGACACATCTGAGAA 0: 1
1: 0
2: 1
3: 26
4: 251
Right 928654857 2:33439977-33439999 GACGCGTTTTGCAAACTAATTGG 0: 1
1: 0
2: 0
3: 2
4: 24
928654855_928654861 22 Left 928654855 2:33439948-33439970 CCCAATGGAGACACATCTGAGAA 0: 1
1: 0
2: 1
3: 26
4: 251
Right 928654861 2:33439993-33440015 TAATTGGGTATGGTTATAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 99
928654855_928654860 19 Left 928654855 2:33439948-33439970 CCCAATGGAGACACATCTGAGAA 0: 1
1: 0
2: 1
3: 26
4: 251
Right 928654860 2:33439990-33440012 AACTAATTGGGTATGGTTATAGG 0: 1
1: 0
2: 1
3: 13
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928654855 Original CRISPR TTCTCAGATGTGTCTCCATT GGG (reversed) Intronic
901243310 1:7707894-7707916 TTCTCTTATGTGACTACATTTGG + Intronic
903424975 1:23246712-23246734 TTTTCAGATGAGCCACCATTTGG - Intergenic
903550060 1:24151716-24151738 TTCTCAGAGGTCCCTCCTTTGGG - Intergenic
904798821 1:33078580-33078602 TTCTCTGAGCTGTCTGCATTTGG - Intronic
905110879 1:35593583-35593605 GCCTCAGAGGTCTCTCCATTTGG - Intronic
905681284 1:39873383-39873405 TTTGTAGATGTCTCTCCATTTGG - Intronic
906906136 1:49894179-49894201 ATCTAAGCTGTGTCTGCATTAGG - Intronic
908353616 1:63310331-63310353 TTCTCAGAAGTGTCCCAGTTTGG - Intergenic
908763267 1:67531635-67531657 TTCTCAAATATATCTTCATTTGG + Intergenic
909023591 1:70459406-70459428 TTCCCAGAAGTGTCTCACTTTGG - Intergenic
909178820 1:72394265-72394287 TTCACAGATGTCACTGCATTAGG - Intergenic
909468508 1:76001076-76001098 GTCTCAGGAGTGGCTCCATTCGG + Intergenic
909839496 1:80301321-80301343 TTCCCACATTTGTCTCCACTGGG + Intergenic
910546767 1:88426663-88426685 ATCTAAGTTGTGTCTGCATTAGG - Intergenic
911176344 1:94821253-94821275 TTCTAAGGGGTGACTCCATTAGG + Intronic
911496289 1:98635689-98635711 TACTCAGATGTGTAGCCCTTTGG - Intergenic
915603027 1:156934228-156934250 TCCTCAGCTGTGTCCTCATTAGG - Intergenic
916603840 1:166321708-166321730 TTCTCAGATATGTCTACACTGGG + Intergenic
916804461 1:168244673-168244695 TTCTGAGATCTGTCTCCAAGAGG - Exonic
918171215 1:181999104-181999126 TTCTCAGCTGTGCCTCCACTAGG - Intergenic
918640632 1:186837353-186837375 TTCCCTGCTATGTCTCCATTTGG - Intronic
919198473 1:194320145-194320167 TTGTCATAAGTGACTCCATTTGG - Intergenic
919341018 1:196306642-196306664 CTCTCAGGTGTGTTTACATTGGG + Intronic
919916390 1:202142293-202142315 GTCTCAGATCTTTCGCCATTGGG - Intronic
920459887 1:206131335-206131357 TTCTCAAACGTGTCTACATGAGG - Intergenic
921235219 1:213119894-213119916 TTCTCAGAAGTGTCCCAGTTTGG - Intronic
921275811 1:213518833-213518855 TTCACATATGTGTATCCATGTGG + Intergenic
1063645898 10:7883299-7883321 TTGTTAAATGTCTCTCCATTTGG + Intronic
1065552498 10:26883276-26883298 CTCTCTGATCTGTATCCATTTGG - Intergenic
1065740742 10:28794914-28794936 TTCTGAGATGTTTCTCAAGTAGG + Intergenic
1065750619 10:28883351-28883373 TTCCCAGATTTGTCTCCTCTGGG + Intergenic
1066581002 10:36882224-36882246 CTCTCTGATCTGTATCCATTTGG - Intergenic
1067746327 10:48939076-48939098 TTCTCAGAATTGTGTCCACTGGG + Intronic
1069899525 10:71699427-71699449 TTCCCACATGTGGCTTCATTTGG + Intronic
1070434292 10:76373611-76373633 TTCCCAAATGTGTCTACCTTTGG + Intronic
1073623274 10:105071046-105071068 TTCTGGGCTGTGTTTCCATTTGG + Intronic
1075652741 10:124139933-124139955 TTATCAGACGTGTCTTGATTCGG - Intergenic
1077199569 11:1298843-1298865 TTGTCAGATGTCTCTTAATTGGG - Intronic
1081154673 11:39675609-39675631 TTTACAGATGTGTTTCTATTAGG - Intergenic
1081757187 11:45553028-45553050 TTCCCAGGTGTGTCTCCAGGTGG - Intergenic
1085939350 11:81189944-81189966 TTCTAAGAAGTGTCTTCATAAGG - Intergenic
1086756690 11:90572826-90572848 AATTCAGATGTGACTCCATTTGG + Intergenic
1089380420 11:118026953-118026975 TTCTCAGATGTTTCTCCAACAGG + Intergenic
1089419639 11:118321847-118321869 TGATCAGATGTGTCTAAATTAGG - Intergenic
1090241970 11:125190235-125190257 TTCTCAAAAGTGTCTCAATTTGG + Intronic
1091632622 12:2173426-2173448 TTCTCAAATGTATCCCAATTTGG - Intronic
1092463698 12:8709525-8709547 ATCTCAGATGTGAATCCAGTTGG + Intronic
1095139586 12:38645352-38645374 TTCTCAGAATTGTCTCCATGAGG - Intergenic
1095606532 12:44074231-44074253 TTCTCAGAAGTGTCCCGTTTTGG - Intronic
1097224152 12:57467239-57467261 TTCTCTGATGTGTGTCCTGTTGG + Intronic
1098604626 12:72374898-72374920 TTCTCAGATGTGTTTTGGTTTGG + Intronic
1100094261 12:91012129-91012151 TTCTCAGATGGGTTTCCAAATGG + Intergenic
1100460504 12:94794738-94794760 TTCCCACAAGTGTCTCAATTAGG - Intergenic
1102794535 12:115676968-115676990 TTCTCAGATGTCTTTCCTTCTGG - Intergenic
1103280303 12:119752687-119752709 TTCTCTGATGTGTCCTCATTAGG + Intronic
1103758648 12:123232283-123232305 TTCAAAGATGCTTCTCCATTTGG + Intronic
1104058277 12:125246843-125246865 GTCTCTGATGTGACACCATTTGG + Intronic
1105248788 13:18677029-18677051 TTCAAAAATGTGTCTACATTTGG - Intergenic
1110354919 13:74556210-74556232 TTATCTGATTTTTCTCCATTTGG + Intergenic
1110434954 13:75469025-75469047 TCCTCAGATTGGCCTCCATTAGG - Intronic
1111482190 13:88844702-88844724 TTCTCTGATTTGGCTTCATTTGG + Intergenic
1111923661 13:94439924-94439946 TGCTTAAATGTGTCTCCATTAGG + Exonic
1112662210 13:101522951-101522973 TTTTGAGATGTCTGTCCATTTGG - Intronic
1114399972 14:22401171-22401193 TTCTCTGCTGTGTCTCCAGCTGG - Intergenic
1115348615 14:32369005-32369027 TTCTCAAAAGTGCCTCCATTGGG - Intronic
1115738242 14:36358561-36358583 TTGTAAAATGTTTCTCCATTTGG - Intergenic
1117723318 14:58647637-58647659 TTCTCAGATGTATCCCCATTCGG + Intronic
1117750088 14:58912395-58912417 TCCTCAGACTTGTCTCTATTAGG - Intergenic
1118737886 14:68715319-68715341 TTCTCTGATGTCTCCTCATTTGG - Intronic
1119807044 14:77488996-77489018 ACCTCAGATGTATCTCTATTTGG - Intronic
1120461619 14:84804703-84804725 TTATCAGATGTTTCACCACTTGG + Intergenic
1120671321 14:87365713-87365735 ACCTCAGATGTGACTCCAGTGGG - Intergenic
1121276969 14:92675039-92675061 TTTTCACATGTGGCTTCATTTGG - Intronic
1121375069 14:93401223-93401245 TTCTAAGATCTGTCTCTCTTTGG - Intronic
1121745782 14:96289916-96289938 TACGCAGAAGTGTCTTCATTAGG - Intronic
1121969012 14:98339352-98339374 GTCTCACATGTCTCACCATTGGG + Intergenic
1122918711 14:104870821-104870843 TTGTAAGATGTATCTCCATGGGG + Intronic
1125391614 15:39198734-39198756 TTCTCAGTTGTGTTTGAATTTGG + Intergenic
1126078445 15:44935599-44935621 TTTTCAGATTTGTCTGGATTGGG + Intergenic
1126079401 15:44944739-44944761 TTTTCAGATTTGTCTGGATTGGG - Intergenic
1126874921 15:53031246-53031268 TTCACAGGTTTGCCTCCATTTGG + Intergenic
1128731026 15:70021321-70021343 TTCTCTTACGTGTCTTCATTCGG - Intergenic
1130984863 15:88838188-88838210 TTCTAAGATGTGTCCCATTTGGG - Intronic
1135926910 16:26702681-26702703 ATCTAAGATGAGTCTCCAGTAGG - Intergenic
1137038497 16:35588276-35588298 TTCTCAGATGTGTTCCTTTTTGG - Intergenic
1138437998 16:57016965-57016987 TTCTCAGATGTGTCTCCGGCAGG + Intronic
1138640038 16:58378293-58378315 ATCTCAAATCTGTCTCCATGAGG + Intronic
1138919270 16:61507259-61507281 ATCTCAGAGATGTCACCATTTGG + Intergenic
1140078849 16:71725395-71725417 ATCTGAGATATGTATCCATTTGG + Intergenic
1140758756 16:78092273-78092295 CTCTCCAATGTGTCTCCATTAGG + Intergenic
1141259436 16:82439413-82439435 CTCTCAGAAGTGTCTTGATTTGG - Intergenic
1142008678 16:87702463-87702485 TGCTCTGATGTGGCTACATTTGG - Intronic
1143070606 17:4289243-4289265 TTAGCAGGTGAGTCTCCATTAGG + Exonic
1144249465 17:13401044-13401066 TTCTCCCATGCGTCTCTATTTGG - Intergenic
1147141121 17:38461134-38461156 TTCGCACATTTGTCTCCCTTGGG + Intronic
1148435647 17:47682397-47682419 TTTTCAGATCTGTTACCATTGGG + Exonic
1149733337 17:58968694-58968716 ATCTCAGATCTGTCTCACTTAGG - Intronic
1150439872 17:65182457-65182479 TTCTCAGCTGTGTGTCCTTGGGG - Intronic
1150538541 17:66072504-66072526 TTATTAAATGTCTCTCCATTAGG + Intronic
1150769271 17:68027615-68027637 CTTTCAGATGTGTCTTGATTAGG + Intergenic
1151225155 17:72642252-72642274 TCCTCTCATTTGTCTCCATTTGG - Intergenic
1151442798 17:74144006-74144028 TTCTCACATGGGTCTCTCTTGGG + Intergenic
1151801254 17:76381275-76381297 TTCTCAGGTGTGTCTCCCTGGGG + Intronic
1153389127 18:4534492-4534514 TTCCCAGATGTGTCTAGATGTGG + Intergenic
1153802393 18:8682727-8682749 TCCTCAGAAGTGTAACCATTTGG - Intergenic
1154378547 18:13828964-13828986 TATTTAGATGTGTCTTCATTTGG + Intergenic
1154440381 18:14383613-14383635 TTCAAAAATGTGTCTACATTTGG + Intergenic
1155017689 18:21861798-21861820 TGCACAGATGTGTCTACTTTTGG + Intronic
1155199552 18:23504924-23504946 CTTTCAGAAGTGTCTCGATTTGG + Intronic
1155642952 18:28041977-28041999 TTCTCAGTGGTGTCTACAGTGGG - Intronic
1155848459 18:30739043-30739065 TTCTCAAAAGTGTCTCAGTTTGG - Intergenic
1157365050 18:47057059-47057081 CTCACAGATGTGTCACCATGTGG + Intronic
1157477624 18:48033519-48033541 TTCCCACAAATGTCTCCATTAGG - Intronic
1158871270 18:61690693-61690715 TTCTCACATGTCCCTCCATAAGG + Intergenic
1159453488 18:68631943-68631965 CTCTCAGATATGTCTTTATTAGG + Intergenic
1161606653 19:5218805-5218827 TTCTCACCTGTGTCTGCTTTCGG - Intronic
1164810668 19:31152810-31152832 GCCTCAGATGCCTCTCCATTGGG - Intergenic
925629674 2:5878039-5878061 TTCACACATGTGACTCCCTTTGG - Intergenic
925858819 2:8155573-8155595 GTCTCAGGTGTGTCTTTATTAGG + Intergenic
927693161 2:25222593-25222615 TTCTCAGACGTGGCTCTGTTTGG - Intergenic
928375358 2:30769206-30769228 TCCTCAGATGTGTCCCCTTAGGG + Intronic
928654855 2:33439948-33439970 TTCTCAGATGTGTCTCCATTGGG - Intronic
928949567 2:36802670-36802692 TTCTGACATTTGTCTCCACTGGG - Intronic
929093232 2:38240239-38240261 TTCCCAGATGTGTTTCATTTTGG + Intergenic
932186416 2:69700146-69700168 TTACAAGATGTGTTTCCATTTGG - Intronic
933400072 2:81784773-81784795 ATCTCAGATGAGCCTCCACTGGG + Intergenic
935290866 2:101610027-101610049 ACCTCAGATGTGACTGCATTTGG + Intergenic
936236888 2:110749939-110749961 TTGTCAAATGTCTCTCAATTTGG + Intronic
937802255 2:126093845-126093867 TTCTTAAATGTGTCTTCATCTGG - Intergenic
938041358 2:128078783-128078805 TTCTCAGATTGGTCTGGATTTGG + Intergenic
939378733 2:141406326-141406348 TTCTCAGAAGTGTCCTGATTTGG - Intronic
939518787 2:143203441-143203463 TTCTCAGTTGTCTCTTCAGTAGG + Intronic
940737782 2:157472657-157472679 TTCTCAGAGGTCACTCCAGTGGG + Intronic
940797866 2:158099584-158099606 TTCTTAGATGTCTCTCCATGGGG - Intronic
941209591 2:162620895-162620917 TTCTCAAATGTGTCCCAGTTCGG - Intronic
941394824 2:164961452-164961474 TTCTCAGAAGTGTCCCTGTTTGG + Intergenic
942050413 2:172134916-172134938 ATCTCAGAAATGGCTCCATTGGG - Intergenic
942173274 2:173307959-173307981 TTTTCAGAAGTGTCTGCTTTTGG + Intergenic
942618546 2:177821787-177821809 TTCTCAAAAGTGTCTAAATTTGG + Intronic
942711435 2:178840526-178840548 TGCTCAGATCTGTCTCTATGAGG + Intronic
943397151 2:187353578-187353600 TTCATAGATGTGTTTCCATTAGG - Intronic
944796027 2:203186301-203186323 TACTCAGATGTGGCTCCTCTTGG + Intronic
945111419 2:206363847-206363869 TTCTCAGATGAATCACCCTTAGG - Intergenic
947256162 2:228166100-228166122 TTCTCAGATCTGTCTCTTTGAGG - Intronic
1169610107 20:7369414-7369436 TTCTCAAAAGTGTCTCTATTTGG - Intergenic
1170151364 20:13230104-13230126 TCCTCAGATGTCTATTCATTTGG + Intronic
1172187976 20:33043284-33043306 TTCTCAGATGTGCTTCAAGTGGG + Exonic
1174470482 20:50756440-50756462 TTCTCAAAAGTGTCCCAATTTGG - Intronic
1174787233 20:53444367-53444389 TTCCCAACTGTGTCTCTATTAGG + Intronic
1174841662 20:53907040-53907062 TTGTCTGATGTGTCTTGATTCGG + Intergenic
1174930271 20:54805753-54805775 CTCTCAGATGGGACTTCATTTGG - Intergenic
1176455654 21:6907563-6907585 TTCAAAAATGTGTCTACATTTGG - Intergenic
1176833826 21:13772611-13772633 TTCAAAAATGTGTCTACATTTGG - Intergenic
1178529095 21:33360062-33360084 TTCTGTGATCTGTCTCCACTTGG + Intergenic
1178746705 21:35258556-35258578 TTCTGACTTGTCTCTCCATTTGG - Intronic
1179222869 21:39425236-39425258 ATCTCAGATGTGTCCACACTTGG - Intronic
1179238007 21:39564269-39564291 TTCTCAAATATGTCTCCACAAGG + Intronic
1179770744 21:43614038-43614060 TTTTCAGCTGTGTTTTCATTAGG - Intronic
1179894645 21:44354570-44354592 AGCTCAGATGTGTCTCCAGGGGG + Intronic
1180745248 22:18084073-18084095 ATCTCAGCTGTGTCTGTATTGGG - Intronic
1184083833 22:42246032-42246054 TTCTCAGTCGTTTCCCCATTTGG + Intronic
1185020632 22:48372719-48372741 CTTCCAGATTTGTCTCCATTTGG - Intergenic
950808501 3:15629133-15629155 TTCTCAGGTGCCTCTCCAATAGG - Intronic
953907993 3:46877963-46877985 TCCACAGATGTGTCTCCATGCGG - Intronic
955646879 3:61149348-61149370 GTCTCAGAAGTGTCTCATTTTGG - Intronic
957106558 3:75896659-75896681 TCCTCAGAGGTGTCTGAATTGGG - Intergenic
957197697 3:77091524-77091546 TTCACAGATGCGTCTGCATCTGG + Intronic
960395558 3:117132535-117132557 TTTGCAGATCTGTCTCTATTGGG + Intronic
960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG + Intronic
961005844 3:123404825-123404847 TGCCCAGATGTGTCCACATTTGG - Intronic
963020285 3:140867209-140867231 TTCTCTGATGTGTCTTAATCTGG + Intergenic
963953282 3:151226033-151226055 TTCCCTGATGTGTTTCCATAGGG - Intronic
964023831 3:152047355-152047377 TTCTCAAAAGTGTCTCAGTTTGG + Intergenic
964256281 3:154778123-154778145 ATCACAGAGGTGTCTCCATAGGG - Intergenic
964337954 3:155677823-155677845 TTCTCAGATATGTCACATTTTGG - Intronic
964609542 3:158596894-158596916 TTCTCATATTTGACACCATTTGG - Exonic
965301915 3:167015762-167015784 TTCTCATATGTGTCTAAATAAGG - Intergenic
966305829 3:178533685-178533707 TTCTCAGATGGGTCTGAGTTAGG + Intronic
966692195 3:182753515-182753537 TTCTCAGAGGTGCTTTCATTAGG + Intergenic
971260528 4:25052784-25052806 GTCTCAGATATGTTTCCAGTGGG + Intergenic
973084800 4:46044608-46044630 TTCTGAGATGTGTCTTCTTTTGG - Intronic
974439640 4:61899490-61899512 TTTTCACCTGTGTTTCCATTGGG - Intronic
974800343 4:66809392-66809414 TTTTCAAAAGTGTCTCCATTTGG - Intergenic
975185920 4:71402616-71402638 TTCACAGATGTGATTCCATCTGG - Intronic
975343467 4:73267399-73267421 TTCTTAAAGGTATCTCCATTTGG - Intergenic
975732981 4:77355764-77355786 TTCTCAGATGTGTATGTATTAGG + Intronic
976203128 4:82599212-82599234 TTCTCAAAAGTGTCCCAATTTGG - Intergenic
979441750 4:120758289-120758311 CTCTCACAAGTGTCTCAATTGGG + Intronic
980392188 4:132161401-132161423 TTCTTAGATGTGTACACATTAGG + Intergenic
981433093 4:144685266-144685288 CTCTCAGAATTGTCTCAATTTGG - Intronic
981520082 4:145652121-145652143 TTCTTATGTGTGTCTTCATTTGG - Intronic
982204931 4:152990483-152990505 TTCTGACATGTGTCCCCATCAGG - Intergenic
982244840 4:153341350-153341372 TTCTCAGAAGTGTCTCAGTTCGG + Intergenic
982750504 4:159155528-159155550 TTATCAGATGTTTCTCTAGTGGG + Intronic
983613992 4:169680679-169680701 TTCTGAGATATTTCTCAATTTGG + Intronic
984678857 4:182583174-182583196 TTCTGGGATGTGTCTCCCTCGGG - Intronic
987445325 5:18010451-18010473 TTTTCAAATGTGTCTCAATTTGG + Intergenic
988498866 5:31767417-31767439 TTCTCAGATGTGTCTGCCAATGG + Intronic
989532318 5:42522672-42522694 TTCTAAGATTTGTTTCCCTTGGG + Intronic
989560170 5:42841311-42841333 TTCTCAGAGCAGCCTCCATTTGG - Intronic
991165865 5:63565079-63565101 ATCCCAGATGTGTCTCTAGTGGG + Intergenic
991312419 5:65258756-65258778 ATCTCAGATGTAACTCCATTTGG - Intronic
994288538 5:97999209-97999231 TTCTGAGATGTTTATCCTTTAGG - Intergenic
994652338 5:102544441-102544463 TTCTTGGAACTGTCTCCATTAGG + Intergenic
994943596 5:106356878-106356900 CTCTCAGATGTGTCCACACTGGG + Intergenic
995971802 5:117981502-117981524 TTTTCAGATTTTTCTGCATTTGG - Intergenic
997315382 5:132930140-132930162 TTCTTAGCTGAGTTTCCATTTGG - Intronic
997724287 5:136107142-136107164 TTCTCACATGACTCTCCAGTTGG - Intergenic
1001326085 5:170725907-170725929 TTCACAGCTGTATATCCATTTGG + Intronic
1002813028 6:652287-652309 TACTAAGATGTGTTTCCGTTGGG - Intronic
1005349724 6:24922195-24922217 TTAGAAGATGTGTCTCCCTTGGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1010455099 6:76045128-76045150 TTCTCAAATGTGTCCCTGTTTGG + Intronic
1011192642 6:84748752-84748774 TTCTCAGATGTGGAATCATTGGG - Intronic
1011483494 6:87818534-87818556 TTTTCAGATGTGTCCCTGTTTGG + Intergenic
1011766017 6:90621054-90621076 TTCTCAGAAGTGTCCAGATTTGG - Intergenic
1012352344 6:98268006-98268028 TTCTAAGATGTTTCTACAGTTGG - Intergenic
1012533470 6:100266967-100266989 TCCTCAGATGTGTAGCCAATAGG - Intergenic
1015622636 6:135147863-135147885 TTATCTGATTTGTCTCCATAGGG + Intergenic
1015683119 6:135830104-135830126 TTCTCAGAGCTTTCTCCATCTGG + Intergenic
1015926976 6:138320469-138320491 TTCACACATGTGGCTCCACTGGG - Intronic
1015988105 6:138906464-138906486 CTCTCAAAAGTGTCTCGATTTGG + Intronic
1016062790 6:139647624-139647646 TTCTCAGAGGTAGCACCATTAGG - Intergenic
1020859994 7:13480063-13480085 TTGCCAAATGTGTCTTCATTTGG - Intergenic
1021760148 7:23895724-23895746 TTCTCAGATGAATCAGCATTGGG - Intergenic
1022413885 7:30161515-30161537 CTCTCAGATCTGCCTGCATTTGG - Exonic
1025092915 7:56078111-56078133 TCCTCAGCTTTGTCTCCCTTGGG - Exonic
1026162692 7:67883497-67883519 TTTTCAGATTTGTCTTAATTTGG + Intergenic
1030165589 7:106552036-106552058 TTCTAGGATGTGTCTAAATTAGG - Intergenic
1030223471 7:107123400-107123422 TTTTCACATTTGTCTCCATAGGG - Intronic
1033350661 7:140559292-140559314 TTATCAGATGTTTCCGCATTTGG - Intronic
1035046228 7:155969034-155969056 TTCTGAAATGTGTCAACATTTGG - Intergenic
1036396495 8:8375912-8375934 TTCTCTGAAGTGTCTTCAGTAGG - Intronic
1037426301 8:18758582-18758604 CTCTCAGATTTGTAACCATTAGG - Intronic
1037558259 8:20048064-20048086 TTATCTGATGTGTTTCAATTTGG + Intergenic
1037754095 8:21700358-21700380 CTCTCAGAAGTGTCTCCTTCAGG - Intronic
1041605917 8:59782175-59782197 TATTAAGATGTGTCTCCATTAGG - Intergenic
1041856863 8:62466961-62466983 TTCTCAAATATCTTTCCATTGGG + Intronic
1043839204 8:85082530-85082552 TTCTCAGTTTTTTCCCCATTAGG + Intergenic
1044055835 8:87568916-87568938 TTCTCAGGTATGTCTTTATTCGG + Intronic
1044608860 8:94072457-94072479 TTGTCAGCTGTGTCCCCCTTTGG + Intergenic
1046062248 8:109153560-109153582 TTCTAAGATCTGTCACCATGTGG + Intergenic
1048564089 8:135576036-135576058 TTTTAAGATGTTTCTCAATTGGG + Intronic
1050776128 9:9262970-9262992 GTATCAGATGTGTTTGCATTTGG - Intronic
1051988206 9:23117608-23117630 TTCTCAAAAGTCTCTCCATATGG + Intergenic
1053146865 9:35718004-35718026 GCCTCATGTGTGTCTCCATTTGG - Intronic
1055167370 9:73213098-73213120 TTTTCAGATGTGTCTTAGTTTGG - Intergenic
1055499758 9:76891201-76891223 TTCTCAGCTGTTTCTTCATTTGG - Intronic
1055716112 9:79120227-79120249 TTATCTGAAGTGTTTCCATTAGG + Intergenic
1056438658 9:86598027-86598049 TTCCCAGATTTTTCTCAATTTGG + Intergenic
1058308971 9:103476946-103476968 TACTTACATTTGTCTCCATTTGG - Intergenic
1058599993 9:106659014-106659036 CTCTCAGAAGTGTCTCAGTTTGG + Intergenic
1058980477 9:110164901-110164923 TTCTCTGGTGTGTCTCCTTCTGG + Intronic
1059016527 9:110522694-110522716 TTGTCAAATGTGTTTCCCTTTGG + Intronic
1059065985 9:111084287-111084309 TTCAGTGATGTGTCTCCATTTGG - Intergenic
1059539828 9:115118855-115118877 TTCTCAGCTGGGTCTCCAGGGGG + Intergenic
1059802065 9:117760180-117760202 TTCTCAAATGTATCCCCATTTGG - Intergenic
1187356649 X:18579875-18579897 TTCTCAGGTGGAACTCCATTTGG - Exonic
1188416770 X:29944861-29944883 TGCCCAGATGTTTCTCCCTTGGG + Intronic
1188549400 X:31345971-31345993 TTGTCATGTGTGTCTCCAGTTGG - Intronic
1191784842 X:64906211-64906233 TTCTCATCTGTCTCTCAATTTGG - Intergenic
1192638395 X:72842521-72842543 TTCCCAGATTAGTCTCCCTTTGG - Intronic
1192643319 X:72878287-72878309 TTCCCAGATTAGTCTCCCTTTGG + Intronic
1192860363 X:75062095-75062117 TTTGCAAATGTGTCTCCTTTTGG - Intronic
1192959411 X:76111225-76111247 ATCTAAGATGTATCTGCATTAGG - Intergenic
1194549063 X:95273844-95273866 TTCCCAGATTTCTCCCCATTCGG - Intergenic
1195167767 X:102237243-102237265 TTTTCAGATGTGTTTCTCTTTGG - Intergenic
1195191090 X:102449844-102449866 TTTTCAGATGTGTTTCTCTTTGG + Intronic
1195798293 X:108678188-108678210 TTCTCAAAACTGCCTCCATTCGG + Intronic
1195802311 X:108726591-108726613 TGCTCACATGTGTATCCATGGGG - Intronic
1197511459 X:127373522-127373544 GTCCCAGATGTGTCTACAATGGG - Intergenic
1197931267 X:131698786-131698808 TCATCAGATGTGTCTCAAATGGG + Intergenic
1198601702 X:138291248-138291270 TTCTCAGACATGACTCCATTAGG - Intergenic
1199012568 X:142775315-142775337 TTCTCAAAAGTGTCCTCATTTGG + Intergenic
1199274763 X:145927444-145927466 ATCTCAGTTGTGTCTGCTTTAGG - Intergenic
1199317120 X:146394266-146394288 ATCTAAGATGTGTCTTCTTTAGG + Intergenic
1201015773 Y:9599960-9599982 TTCTCAGCTGTGGCTCAAGTGGG - Intergenic
1201054674 Y:9976732-9976754 TTCTCAGCTGTGTATTCTTTAGG - Intergenic
1202191705 Y:22252717-22252739 TTCTCAGCTGTGTGTTCTTTAGG + Intergenic