ID: 928664149

View in Genome Browser
Species Human (GRCh38)
Location 2:33533717-33533739
Sequence CAGGAACCGGTCAGAAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928664149_928664153 -8 Left 928664149 2:33533717-33533739 CCCTGATTTCTGACCGGTTCCTG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 928664153 2:33533732-33533754 GGTTCCTGGAGCACTTAAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928664149 Original CRISPR CAGGAACCGGTCAGAAATCA GGG (reversed) Intronic
904149500 1:28425874-28425896 TAGAAACTAGTCAGAAATCAAGG - Intronic
905919707 1:41711267-41711289 CAGGAAGAGGCCAGAAATCAAGG + Intronic
906781601 1:48577596-48577618 CAGGAGACATTCAGAAATCAGGG + Intronic
915826252 1:159080637-159080659 CAGGAACCTGTCAGAAATGCTGG - Intronic
916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG + Intronic
916385527 1:164263328-164263350 CAGGAACCTCACAGAAATCCAGG + Intergenic
917408341 1:174733171-174733193 GAGGAAGCGGTCAGACTTCAAGG + Intronic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
920387821 1:205580701-205580723 CAGGAAAGGGTCAGCAATAAGGG - Exonic
921090273 1:211835604-211835626 GAGGAACAGGGTAGAAATCAGGG - Intergenic
1062955667 10:1538761-1538783 CAGGAACTCAGCAGAAATCAGGG + Intronic
1066101360 10:32121500-32121522 CAGGATATGGTCAGAAATCTTGG + Intergenic
1073432864 10:103497943-103497965 CAGGAACTGGACAGAAAGCAAGG + Intronic
1074719637 10:116253299-116253321 CAGGCACCGGACAGAAACCAGGG + Intronic
1081461325 11:43275299-43275321 GAGGAAAAGATCAGAAATCACGG + Intergenic
1082850673 11:57761724-57761746 TAGGAACCAGGCATAAATCAGGG - Intronic
1084266275 11:68007031-68007053 CAGGACACAGTCAGAACTCACGG - Intergenic
1089372210 11:117969426-117969448 CAGGCACCTATCAGAAATCACGG - Intergenic
1092038620 12:5363471-5363493 CAGGAACTTGCCAGAAATGAAGG + Intergenic
1096645332 12:53030906-53030928 GAGGAAAAGGTCAGAAGTCAAGG - Intronic
1099020959 12:77404099-77404121 CAGGAAAGGGTCAGAAGCCATGG - Intergenic
1100869069 12:98892128-98892150 CAGCATCTGGTCAGAAATGAGGG + Intronic
1102308753 12:111827261-111827283 CAGAAACAGGTCAGAAAGCAGGG + Intergenic
1103669785 12:122603921-122603943 CAGGAACTGGTTAGAAAATAGGG + Intronic
1109281153 13:60357165-60357187 GAGGAACTGGTTAGAAAACAAGG + Intergenic
1113093803 13:106641645-106641667 AAGGTAAAGGTCAGAAATCAAGG - Intergenic
1116339954 14:43709703-43709725 CAGAATGCGGTCAGAAATGATGG - Intergenic
1118725542 14:68626227-68626249 CAGGCACAGCTCAGAAAGCAGGG + Intronic
1118923143 14:70168126-70168148 CATGAAGCGGTCAGCAATGATGG + Exonic
1119661659 14:76456576-76456598 CTGCAACCTGTCAGAAATGAAGG - Intronic
1126466011 15:48962517-48962539 CAGGAAGCGGGCACGAATCAGGG + Exonic
1128523656 15:68392305-68392327 CAGGCACTGGACAGCAATCAAGG + Intronic
1135908926 16:26541578-26541600 AAGGAACATGCCAGAAATCAAGG + Intergenic
1140583788 16:76262787-76262809 CAGGAACCAGTCATGATTCATGG - Intergenic
1142204011 16:88774088-88774110 CAGGAACCGGTCACCAGGCAGGG + Intronic
1143560217 17:7689252-7689274 CAGGAACCACTGAGAAATCGAGG - Exonic
1145294447 17:21576472-21576494 CAGGATCCAGGGAGAAATCAGGG - Intergenic
1145346497 17:22044976-22044998 CAGGCACCGGGCAGCAACCAGGG + Intergenic
1145369385 17:22296708-22296730 CAGAATCCAGTGAGAAATCAGGG + Intergenic
1146185128 17:30719749-30719771 CAGGAACCGGACAGTCATCCTGG - Intergenic
1146780427 17:35666235-35666257 CAGTAACTGGACAGAAAACAGGG - Intronic
1148094846 17:45045200-45045222 CAGGACACGGACAGAAAGCAGGG + Intronic
1148779639 17:50114074-50114096 CAGGAACTGGGCAGAGACCAAGG + Exonic
1149091069 17:52780253-52780275 TAGAAACCTGACAGAAATCAAGG - Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154293104 18:13127614-13127636 AAGAAACCGGTAAGAAATCTTGG - Intergenic
1157151690 18:45224531-45224553 CAGGAAACCTTCAGAAATCTTGG + Intronic
1160203029 18:76810749-76810771 GAGGAACCTGTCAGATATCGAGG - Intronic
1162450909 19:10754203-10754225 CAGGAAAAGGTCACAAGTCAAGG - Intronic
1162973652 19:14195940-14195962 CAGGAACCGGACAGTCATCCTGG + Intronic
1164497171 19:28777262-28777284 CTGGAACAGCTCAGAAATCTGGG + Intergenic
925150635 2:1612453-1612475 GAGGAACTGGTCGGATATCAAGG - Intergenic
928664149 2:33533717-33533739 CAGGAACCGGTCAGAAATCAGGG - Intronic
929836539 2:45406182-45406204 CAGCAACCTGGCAGAAGTCAGGG + Intronic
931233277 2:60392107-60392129 CAGGAACCCGGCAGGAAGCAAGG - Intergenic
934477892 2:94604982-94605004 CAAGAACCGGCCAGAACTCGGGG - Intergenic
934846881 2:97666952-97666974 GAGGAACAGGTCAGAGACCAAGG - Intergenic
937295103 2:120805325-120805347 TAGGAACCAGCCAGAAAACAAGG - Intronic
938550979 2:132382299-132382321 GAGGAACTGATCAGATATCAAGG + Intergenic
940271097 2:151891197-151891219 AAGAAACCTGTCTGAAATCAGGG - Intronic
941072907 2:160974862-160974884 CAAGAACAGATCAGAAATCTTGG - Intergenic
945050775 2:205822108-205822130 GAGGACCCGGTCAGGAAACAAGG + Intergenic
945128374 2:206538899-206538921 CAGGAACTGGACAGGCATCATGG - Intronic
945849356 2:214986723-214986745 CAGGACCTGGAGAGAAATCAAGG + Exonic
1169792569 20:9427292-9427314 CAGGAAGGGTTCAGAACTCATGG - Intronic
1173336328 20:42115062-42115084 CAGCAACAGATCAGCAATCAGGG - Intronic
1175209975 20:57348150-57348172 CAGGCACAGGACAGACATCATGG + Intergenic
1180217554 21:46335259-46335281 CAGGAACGTGGCAGAAACCAGGG - Intronic
1181145330 22:20841869-20841891 AAGGAAGGGGCCAGAAATCAAGG + Intronic
1183070176 22:35390694-35390716 CAAGAACCCCTCAGAAATCATGG + Intronic
1183138911 22:35917362-35917384 CAGGAAAATGTCAGAAAGCAAGG + Intronic
951287479 3:20832500-20832522 TAGGAACCTGGCAGAAATAAAGG - Intergenic
951760470 3:26142122-26142144 CAGAAAACTGTCAGTAATCATGG - Intergenic
952039720 3:29247496-29247518 TAGGCAGAGGTCAGAAATCAAGG - Intergenic
954888298 3:53897680-53897702 CAGGAACAGGTCAGCACCCAGGG - Intergenic
955259033 3:57365939-57365961 CAGGTACAAGTCAGAAGTCATGG + Intronic
960100594 3:113738330-113738352 CAGTAACCAGTCAGAAATATTGG - Intronic
961718538 3:128875989-128876011 TAAAAACCGGACAGAAATCACGG - Intergenic
962892098 3:139680908-139680930 CAGCGACAGGTCAGAAGTCAAGG - Intergenic
969958474 4:10917582-10917604 CAGGAACAGGTCTGAAATACTGG + Intergenic
971730911 4:30378731-30378753 CTTGAAATGGTCAGAAATCAAGG + Intergenic
973758430 4:54096758-54096780 CAGGAACGGGTCAGAACTCTGGG + Intronic
974770667 4:66407401-66407423 CATGAAAAGGTCAGAAATTAAGG + Intergenic
977876716 4:102158283-102158305 CAGGTACCGGTCAGCAGCCAGGG + Intergenic
978486665 4:109262120-109262142 AATGAACAGGTTAGAAATCAAGG - Intronic
983472738 4:168176567-168176589 CAGGAACCGGTAAGAAATTTGGG + Intronic
985178128 4:187225216-187225238 CAGGAACCGGGAAGAAGTGATGG - Intergenic
985358247 4:189144299-189144321 CAAGAATAGGTCAAAAATCAGGG - Intergenic
987212887 5:15702093-15702115 CAGGAACCGGCCAGCACTCCTGG - Intronic
993638474 5:90373818-90373840 TGGCAACCTGTCAGAAATCAGGG + Intergenic
999278291 5:150347005-150347027 CAGGAACAGCTCAGAACCCAGGG + Intergenic
1002579537 5:180199358-180199380 CAGGATCCGGTCAGTGATGAAGG - Intronic
1003995375 6:11535400-11535422 CACGTTCCTGTCAGAAATCAGGG - Intergenic
1010249663 6:73694836-73694858 CAGGAACAGGTCAGCACCCAGGG + Intergenic
1013319038 6:108968575-108968597 CACGACCCGGTCAGAAGTCAGGG - Intronic
1013587307 6:111591146-111591168 CATGAACAGGTCAGAATGCAGGG - Intronic
1029454745 7:100663373-100663395 CAGGAAATGGGCAGGAATCAAGG + Intergenic
1033174278 7:139110233-139110255 GAGGAACCGATCTGAAATCTTGG - Intergenic
1034378085 7:150664403-150664425 GAGGAATAGGTCAGAAACCAGGG + Intergenic
1034724480 7:153322561-153322583 CAGAAACGGGTCAGAAAACCTGG - Intergenic
1043550217 8:81363170-81363192 CAGGAAACAGTAAAAAATCAAGG - Intergenic
1046901960 8:119533434-119533456 CAGGAATCTCTCAGAATTCATGG - Intergenic
1047414634 8:124653941-124653963 CAGGAAGCGGTTAGACATCCTGG + Intronic
1050193972 9:3060926-3060948 CAGGAATTTTTCAGAAATCAAGG + Intergenic
1051814705 9:21091820-21091842 CAGGAAATGGCCAGAAAGCAGGG + Intergenic
1052852062 9:33384580-33384602 CAAGAACCGGCCAGAACTCAGGG + Intergenic
1053680169 9:40481125-40481147 CAAGAACCGGCCAGAACTCGGGG + Intergenic
1053930162 9:43109435-43109457 CAAGAACCGGCCAGAACTCGGGG + Intergenic
1054283543 9:63143810-63143832 CAAGAACCGGCCAGAACTCGGGG - Intergenic
1054293249 9:63316635-63316657 CAAGAACCGGCCAGAACTCGGGG + Intergenic
1054391277 9:64621128-64621150 CAAGAACCGGCCAGAACTCGGGG + Intergenic
1054504452 9:65895199-65895221 CAAGAACCGGCCAGAACTCGGGG - Intergenic
1055924476 9:81495615-81495637 CAGGACCCGTTCAGAAAGCTGGG + Intergenic
1059286995 9:113182329-113182351 CAGGAACAGGTCAAAATTCCTGG + Intronic
1060995381 9:127872713-127872735 CAAGAAGCTGTCGGAAATCATGG - Exonic
1186255413 X:7713136-7713158 CAGGAAAGGCTGAGAAATCAGGG - Intergenic
1195417846 X:104640320-104640342 AAGGAACCAGTCAGAAATTCTGG - Intronic