ID: 928665497

View in Genome Browser
Species Human (GRCh38)
Location 2:33547240-33547262
Sequence CGCTGGTGCCTCCTTGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 573}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928665497 Original CRISPR CGCTGGTGCCTCCTTGATGG CGG Intronic
900524092 1:3120035-3120057 TGCTGGTGCCTCCTTGCTCAGGG + Intronic
900924747 1:5697680-5697702 CCCTGATGCTTCCTTGATGTTGG + Intergenic
901058453 1:6460544-6460566 CGCTGGCGCATCCTGGGTGGAGG + Exonic
903072996 1:20737118-20737140 CCCTGCTGACTCCTTGATGTTGG + Intergenic
903372177 1:22843502-22843524 CACTGGGGCCTACTTGAGGGTGG - Intronic
903535647 1:24064525-24064547 CCCTGGGGGCTCCTGGATGGAGG + Intronic
904627747 1:31816485-31816507 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
906682807 1:47742087-47742109 CACTGGGGTCTACTTGATGGTGG + Intergenic
906836784 1:49092015-49092037 CACTGGGGCCTACTTGAGGGTGG + Intronic
906997538 1:50813051-50813073 CACTGGGGCCTCCTTGAGAGTGG + Intronic
907663739 1:56416365-56416387 CGCTGGCCCCTCCCTCATGGTGG - Intergenic
908819847 1:68074199-68074221 CGCTGGGGCCTACTGGAGGGTGG - Intergenic
908956458 1:69635086-69635108 CGCTGGTGCCTTTTGGAGGGTGG - Intronic
910166355 1:84331893-84331915 CACTGGGGCCTACTTGAGGGTGG - Intronic
910511271 1:88007980-88008002 CTGTGGTGCCTCCTTTCTGGTGG - Intergenic
910592246 1:88938541-88938563 CACTGGGGCCTCCTTGAGGGTGG - Intronic
910731631 1:90403974-90403996 CACTGGGGCCTACTTGAGGGTGG - Intergenic
911641725 1:100297060-100297082 CACTGGGGCCTACTTGAAGGTGG - Intergenic
915696210 1:157745159-157745181 CGCTGGGGTCTACTTGAGGGTGG + Intergenic
915756331 1:158263979-158264001 CACTGGGGCCTCCTTGAGGATGG - Intergenic
916017860 1:160766079-160766101 CACTGGGGCCTACTTGAGGGTGG - Intergenic
916124170 1:161554521-161554543 CACTGGGGCCTACTTGAGGGTGG + Intergenic
916134052 1:161635881-161635903 CACTGGGGCCTACTTGAAGGTGG + Intronic
916373865 1:164130103-164130125 CACTGGGGCCTACTTGAGGGTGG + Intergenic
916448853 1:164899907-164899929 CACTGGGACCTCCTTGAGGGTGG + Intergenic
917261734 1:173176956-173176978 CACTGGGGCCTACTTGAGGGTGG + Intergenic
917810508 1:178653675-178653697 GGATGGTGGCTCCTGGATGGTGG - Intergenic
918024421 1:180729000-180729022 CACTGGGGCCTACTTGAGGGTGG - Intronic
918581993 1:186142161-186142183 CACTGGGGCCTACTTGAGGGAGG - Intronic
919221650 1:194638288-194638310 CACTGGGGCCTCCTGGAAGGCGG - Intergenic
920687955 1:208124202-208124224 CACTGGGGCCTACTTGAGGGTGG + Intronic
920850127 1:209623041-209623063 CGGTGGGGCCTTCTTGATGGCGG - Exonic
920870886 1:209793726-209793748 CACTGGGGCCTCCTTGAGGACGG - Intronic
921390631 1:214609744-214609766 CACTGAGGCCTCCTTGAGGGTGG - Intronic
923189552 1:231607250-231607272 CACTGGTGTCTACTTGAGGGTGG - Intronic
923248630 1:232158916-232158938 CGCTGGGGCCTACTTGAGGGTGG + Intergenic
924069921 1:240266190-240266212 CACTGGGGACTCCTAGATGGGGG - Intronic
924212961 1:241789717-241789739 CACTGGGGCCTACTTGAGGGTGG + Intronic
924702319 1:246466510-246466532 CACTGGGGCCTCCTTGAGGGTGG + Intronic
1063671938 10:8105959-8105981 CTCTGGGGCCTCCTCGAGGGTGG - Intergenic
1063752258 10:8963602-8963624 CACTGGGGTCTACTTGATGGGGG + Intergenic
1064541208 10:16406813-16406835 CGCTGGGGTCTCCTTGATGAGGG - Intergenic
1064621312 10:17220394-17220416 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1066162455 10:32748196-32748218 CACTGGGGCCTACTTGAGGGTGG + Intronic
1066426880 10:35315269-35315291 CACTGAAGCCTCCTTGAGGGAGG - Intronic
1067730964 10:48811295-48811317 CCCTGTTGCCTCCTACATGGTGG + Intronic
1068029188 10:51686303-51686325 CACTGGGGCCTACTTGATGGGGG - Intronic
1068067467 10:52149659-52149681 ACCTGGTGGCTCCTTGATCGTGG + Intronic
1068708467 10:60104062-60104084 CACTGGGGCCTACTTGAAGGTGG + Intronic
1068832609 10:61514545-61514567 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1069964372 10:72101970-72101992 CACTGGGGCCTCCTTGAGGGTGG + Intronic
1070282962 10:75063153-75063175 AGCTGCTGCCCCCTTAATGGAGG - Intergenic
1071380199 10:85051874-85051896 CACTGGGGTCTACTTGATGGGGG + Intergenic
1071770162 10:88720353-88720375 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1071772964 10:88750634-88750656 CACTGGGGCCTACTTGAGGGTGG + Intronic
1072076443 10:91978984-91979006 CACTGGGGCCTACTTGAGGGTGG - Intronic
1073485657 10:103817313-103817335 CACTGGGGCCTACTTGAGGGTGG - Intronic
1074001085 10:109373569-109373591 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1074746188 10:116534861-116534883 CACTGGTGCCTATTTGAGGGTGG - Intergenic
1074874701 10:117604650-117604672 CTTTGGTGCCTCCGGGATGGAGG + Intergenic
1075342467 10:121658424-121658446 CACTGGGGCCTGCTTGAGGGTGG + Intergenic
1076592996 10:131602005-131602027 TGCTGGGGTCTCCTTGAGGGTGG + Intergenic
1076597387 10:131632556-131632578 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1076609934 10:131718177-131718199 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1076942899 10:133621767-133621789 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1077841226 11:5976875-5976897 CGCTGGGGCCTACTTGGTGGTGG - Intergenic
1078380790 11:10838419-10838441 CACTGGTGCCTACTTGAGGATGG - Intronic
1079555577 11:21754434-21754456 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1079680271 11:23287750-23287772 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1080094108 11:28383966-28383988 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1080294672 11:30713069-30713091 CGAGGCTGCCTCCTTGATAGGGG + Intergenic
1080724486 11:34881915-34881937 CACTGGGGTCTACTTGATGGCGG + Intronic
1081452980 11:43191123-43191145 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1082673795 11:56070365-56070387 TACTGGTGCCTACTTGAGGGTGG - Intergenic
1082700544 11:56424404-56424426 CCCTGGGACCTCCTTGAAGGTGG + Intergenic
1082869119 11:57927681-57927703 CACTGGGGACTACTTGATGGAGG - Intergenic
1082873563 11:57965979-57966001 CACTGGGGCCTCCTTGATGGTGG - Intergenic
1083114746 11:60449753-60449775 CACTGGGGCCTACTTGAGGGTGG + Intronic
1083520789 11:63310686-63310708 TGCTGGGGCCTACTTGAGGGTGG + Intronic
1083677772 11:64336560-64336582 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1084439312 11:69162646-69162668 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1084725209 11:70937365-70937387 CACTGCTGCCTGCCTGATGGAGG + Intronic
1084957592 11:72699519-72699541 CGCTGGTGTGTCCTTGGTGACGG - Exonic
1085790060 11:79489463-79489485 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1085939710 11:81194812-81194834 CACTGGGGTCTACTTGATGGTGG - Intergenic
1086164645 11:83763334-83763356 CACTGGAGTCTACTTGATGGTGG - Intronic
1086526407 11:87732245-87732267 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1086592172 11:88527917-88527939 CACTGGGGCCTCCATGAGGGTGG + Intronic
1086846490 11:91755951-91755973 CACTGGTGACTACTTGAGGGTGG - Intergenic
1087362266 11:97176007-97176029 CACTGGGGCCTACTTGACGGTGG + Intergenic
1087614801 11:100475480-100475502 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
1087842818 11:102937504-102937526 CACTGGGGCCTACTTGAGGGAGG + Intergenic
1087912085 11:103765792-103765814 CACTGGAGCCTACTTGAGGGAGG - Intergenic
1088099413 11:106138630-106138652 CTCTGGGGCCTACTTGAGGGTGG + Intergenic
1088928329 11:114324347-114324369 CACTGGGGCCTACTTGAAGGTGG - Intergenic
1089069103 11:115685371-115685393 CACTGGAGCCTCCTTGAGGGTGG + Intergenic
1089202566 11:116733213-116733235 GGCTGGTGCCTGCTTGATGCAGG + Intergenic
1089506963 11:118969875-118969897 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1090096628 11:123748379-123748401 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1090447313 11:126775403-126775425 GGCTGGTAACTCCTTGAAGGGGG + Intronic
1090495691 11:127209874-127209896 CACTGGGGTCTACTTGATGGTGG + Intergenic
1090924280 11:131235947-131235969 CGCTAGAGCCTCCTTGGGGGCGG - Intergenic
1092024393 12:5228608-5228630 CTCTGGGGCCTCTTTGATGAGGG + Intergenic
1092342105 12:7685568-7685590 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1092441108 12:8505179-8505201 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1092581001 12:9841296-9841318 CACTGGGGCCTACTTGAGGGTGG + Intronic
1093218495 12:16390454-16390476 CACTGGGGCCTACTTGAGGGTGG - Intronic
1093491812 12:19713569-19713591 CACTGGAGCCTACTTGAAGGTGG - Intronic
1093497394 12:19774187-19774209 CCCTGGGGCCTACTTGAAGGTGG - Intergenic
1093498428 12:19783343-19783365 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1094167898 12:27461412-27461434 CGCTGGGGACTACTTGAAGGTGG - Intergenic
1094226006 12:28046959-28046981 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1095153822 12:38827804-38827826 CACTGGAGCCTACTTGAGGGTGG + Intronic
1095842912 12:46714028-46714050 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1096346845 12:50856043-50856065 CACTGGGGCCTACTTGAGGGTGG + Intronic
1096362642 12:51001370-51001392 CACTGGGGTCTACTTGATGGGGG + Intronic
1096748714 12:53745282-53745304 CTCTGGTGCCTCCTGGATTCTGG + Intergenic
1096894258 12:54804468-54804490 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1097557643 12:61159595-61159617 CACTGGGGTCTACTTGATGGGGG + Intergenic
1097567734 12:61292341-61292363 CACTGGGGCCTACGTGATGGTGG + Intergenic
1097610700 12:61816181-61816203 CACTGGGGTCTACTTGATGGTGG - Intronic
1097620912 12:61938453-61938475 CACTGGAGCCTACTTGAGGGTGG + Intronic
1098508530 12:71283557-71283579 CACTGGGGCCTACTTGAGGGTGG - Intronic
1098776523 12:74627039-74627061 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
1098945721 12:76587435-76587457 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1099372036 12:81846102-81846124 CACTGGGGCCTTCTTGAGGGTGG - Intergenic
1099630906 12:85144071-85144093 CACTGGGGCCTACTTGAGGGCGG - Intronic
1100094526 12:91016032-91016054 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1100637992 12:96454161-96454183 CGCTGGGGTCTCCTTGAGGGTGG + Intergenic
1101067318 12:101035836-101035858 CACTGGGGCCTACTTGAGGGTGG + Intronic
1102671887 12:114626733-114626755 CACTGGTGCCTACTTGAGGGGGG + Intergenic
1104537379 12:129630862-129630884 CACTGGGGCCTGCTTGAGGGTGG - Intronic
1104619106 12:130297189-130297211 TGCTGGGGCCTACTTGAGGGTGG + Intergenic
1106426905 13:29639936-29639958 CCCTGGGGCCTACTTGAGGGTGG - Intergenic
1106520997 13:30497611-30497633 CACTGGGGCCTACTTGAGGGTGG - Intronic
1107116107 13:36747390-36747412 CGCTGGGGCCTACCTGAGGGTGG - Intergenic
1107396724 13:40025666-40025688 TGCTGGTGACTACTAGATGGGGG + Intergenic
1108467876 13:50736336-50736358 CACTGGGGCCTACTTGAGGGTGG + Intronic
1108765887 13:53628990-53629012 CACTGCTGCCTCCTAGAGGGTGG - Intergenic
1109133256 13:58614451-58614473 CACTGGGGCTTCCTTGAGGGTGG + Intergenic
1109158291 13:58939346-58939368 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1109167602 13:59055498-59055520 CACTGGGGCTTCCTTGAGGGTGG + Intergenic
1109254950 13:60068654-60068676 CACTGGAGCCTACTTGAGGGTGG - Intronic
1109259064 13:60121494-60121516 TGTTGGTTCCTCCTTGTTGGTGG - Intronic
1109589627 13:64460952-64460974 CACTGGTGCCTACTTGAGGGCGG - Intergenic
1109628903 13:65017805-65017827 CACTGGAGCCTGCTTGAAGGTGG - Intergenic
1110246477 13:73330697-73330719 CACTGGTGCCTACTTGACGGTGG + Intergenic
1110523316 13:76506225-76506247 CACTGGAGCCTACTTGAGGGTGG + Intergenic
1110610488 13:77482064-77482086 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1110877988 13:80534617-80534639 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1111370313 13:87308368-87308390 TGCTGGGGCCTAATTGATGGTGG + Intergenic
1111449914 13:88401521-88401543 CTCTGGGGCCTACTTGAGGGTGG - Intergenic
1111532790 13:89561471-89561493 TACTGGGGCCTCCTTGAGGGTGG + Intergenic
1111638060 13:90931146-90931168 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1112227403 13:97553293-97553315 CGCTGGGACCTACTTGAGGGTGG - Intergenic
1112351377 13:98637475-98637497 CACTGGGTCCTCCTTGAGGGTGG - Intergenic
1112460262 13:99597826-99597848 TGCTGGGGCCTACTTGAGGGTGG - Intergenic
1112912571 13:104506283-104506305 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1112916605 13:104558753-104558775 TGCTGGGGTCTACTTGATGGTGG - Intergenic
1113710242 13:112458670-112458692 CTCTGGGGCCTACTTGACGGTGG - Intergenic
1114057769 14:18988795-18988817 CACTGGGGCCTACTTGAGGGTGG - Intronic
1114083268 14:19219568-19219590 CTCTGGTGCTTCGTTGATGGGGG - Intergenic
1114104778 14:19412958-19412980 CACTGGGGCCTACTTGAGGGTGG + Intronic
1114374354 14:22127877-22127899 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1114394580 14:22345495-22345517 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1114589314 14:23845347-23845369 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1114763688 14:25346506-25346528 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1114902539 14:27082435-27082457 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1115283264 14:31688821-31688843 CACTGGGGCCTACTTGAGGGTGG - Intronic
1116120142 14:40712353-40712375 CACTGGAGCCTACTTGAGGGTGG + Intergenic
1116535574 14:46024505-46024527 CACTGGGGCCTACCTGATGGTGG + Intergenic
1116558684 14:46347575-46347597 CACTGGGGCCTGCTTGAGGGTGG + Intergenic
1117671835 14:58115892-58115914 CACTGGGGCCTACTTGAGGGTGG + Intronic
1117821348 14:59652662-59652684 CACTGGGGCCTACTTGAGGGTGG + Intronic
1118877886 14:69799779-69799801 CACTGGGGCCTACTTGAGGGAGG - Intergenic
1119543930 14:75458327-75458349 CACTGGGGCCTACTTGAGGGTGG - Intronic
1121730219 14:96181625-96181647 CTCTGTCGGCTCCTTGATGGAGG - Intergenic
1121942494 14:98085459-98085481 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1122078618 14:99251804-99251826 GGCTGGTGGGGCCTTGATGGCGG - Intronic
1122864096 14:104595751-104595773 CACAGATGCCTCCGTGATGGGGG - Intronic
1123115168 14:105891252-105891274 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123117352 14:105900699-105900721 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123119443 14:105909968-105909990 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123121651 14:105919563-105919585 CTCTGGGGCCTCCTGGATGGGGG + Intronic
1123404361 15:20011214-20011236 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123513696 15:21017861-21017883 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123935122 15:25190380-25190402 CACTGGTGCCTCCTTGAGCCTGG + Intergenic
1123938436 15:25205212-25205234 CACTGGTGCCTCCTTGAGCCTGG + Intergenic
1124122625 15:26903116-26903138 CACTGGAGCCTTCTTGAGGGTGG - Intronic
1125366796 15:38926228-38926250 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1125529178 15:40400583-40400605 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1125814397 15:42572141-42572163 CCCTGGTGCCTCATTCATCGTGG - Intergenic
1126223768 15:46245493-46245515 CACTGGGGTCTGCTTGATGGGGG - Intergenic
1126659296 15:51016438-51016460 CACTGGGGGCTCCTTGAGGGTGG + Intergenic
1126690553 15:51285977-51285999 AGCTGGTGCCGTCTGGATGGGGG - Intronic
1127055138 15:55123663-55123685 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1129183121 15:73889361-73889383 CAGTGGCTCCTCCTTGATGGAGG + Intergenic
1131531288 15:93194827-93194849 CACTGGGGCCTCCTGGAGGGTGG - Intergenic
1131982919 15:98012997-98013019 CGCTGGGACCTACTTGAGGGTGG + Intergenic
1132144643 15:99421785-99421807 CACTGGGGCCTCCTTGAGAGTGG - Intergenic
1132288651 15:100684156-100684178 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
1132308341 15:100835194-100835216 CGCTCGGGCCTCCTTGAGGGTGG - Intergenic
1132328037 15:100988304-100988326 CACTGGGGACTACTTGATGGTGG - Intronic
1132544837 16:528214-528236 CGCTGGCGCCTCCAGGCTGGTGG + Intronic
1133706193 16:8357328-8357350 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1133774430 16:8886089-8886111 GGCTGCTGCCTCCTTCAAGGAGG - Intergenic
1135007466 16:18839349-18839371 CACTGGGGCCTACTTGAGGGTGG - Intronic
1135533013 16:23270649-23270671 TGCTGGGGCCTGCTTGAGGGTGG - Intergenic
1136640586 16:31561629-31561651 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1136911858 16:34150278-34150300 CGCGGGAGCCTACTTGAGGGAGG + Intergenic
1137562116 16:49509628-49509650 CCCTGGTCTCTCGTTGATGGGGG + Intronic
1137837144 16:51603467-51603489 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1138291328 16:55849639-55849661 CGGTGGTGCCTTCCTGAAGGGGG - Exonic
1138630464 16:58290671-58290693 AGCCAGTGCCTCCGTGATGGCGG + Intronic
1138752921 16:59445771-59445793 CACTGGGGCCTCCTTGAGGATGG - Intergenic
1142247193 16:88975583-88975605 GGCTGGTGCTGCCTTGAAGGTGG + Intronic
1143966162 17:10757776-10757798 AGCTGAGGCCTCCTTGATGGGGG - Intergenic
1144701363 17:17343053-17343075 CGCTGGTGCAGGCTGGATGGGGG - Intronic
1145720777 17:27070501-27070523 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1148469007 17:47882020-47882042 CTCTGGTACCACCTGGATGGTGG - Intergenic
1149198082 17:54147693-54147715 CACTAGTGCCTACTTGAGGGTGG - Intergenic
1149325335 17:55524081-55524103 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1149366973 17:55954416-55954438 CACTGGAGCCTCCTTGAGGGAGG - Intergenic
1149624590 17:58071579-58071601 CACTGGGGTCTACTTGATGGAGG + Intergenic
1149742038 17:59055758-59055780 CACTGGGGCCTACTTGAGGGTGG + Intronic
1149948053 17:60952776-60952798 CACTGGGGCCTCCTTGAGGGTGG - Intronic
1150066984 17:62118826-62118848 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1150831665 17:68526751-68526773 CACTGGGGCCTACTTGAGGGTGG + Intronic
1150846778 17:68666474-68666496 CGCTGGGGTCTACTTGAGGGGGG - Intergenic
1150871805 17:68920235-68920257 CACTGGGGTCTACTTGATGGGGG + Intronic
1153329145 18:3855265-3855287 CTCTGGGGCCTACTTGAGGGTGG + Intronic
1153543462 18:6181670-6181692 TGCTGGGGCCTACTTGAAGGTGG - Intronic
1155110107 18:22706404-22706426 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1155246655 18:23917026-23917048 CCCTGGGGCCTACTTGAGGGTGG - Intronic
1155335518 18:24760705-24760727 CACTGGGGCCTGCTTGAGGGTGG + Intergenic
1155773736 18:29732557-29732579 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1158688757 18:59641431-59641453 CTCTGGGGCCTGCTTGAGGGTGG + Intronic
1158738085 18:60106926-60106948 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1158744322 18:60180923-60180945 CACTGGAGCCTACTTGAGGGTGG + Intergenic
1160218850 18:76957668-76957690 CACTGGGGCCTCCTTGAGGGAGG - Intronic
1160549401 18:79683727-79683749 CCCTGGTGGCTCCTTGGTGAGGG + Intronic
1165146283 19:33732869-33732891 CCATGGTACCTCCTTCATGGAGG + Intronic
1165968091 19:39601676-39601698 CACTGGGGCCTCCTTGAGGGTGG + Intergenic
1166176238 19:41073323-41073345 CACTGGGGCCTCCCTGAGGGTGG + Intergenic
1166398645 19:42461552-42461574 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1166409132 19:42544725-42544747 CACTGGGGCCTACTTGAGGGTGG - Intronic
1167001172 19:46746421-46746443 CCCCGGGGCCTCCATGATGGAGG - Exonic
1167764759 19:51474407-51474429 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
924985150 2:264052-264074 CGCTGGGGCCTCCTTGTCCGCGG - Exonic
926595238 2:14782941-14782963 CACTGAGGCCTCCTTGAGGGTGG + Intergenic
927273490 2:21239761-21239783 CACTGGGGCCTACTTGAGGGTGG - Intergenic
927603859 2:24468487-24468509 CACTTGTGCCTACTTGAGGGTGG - Intergenic
927951104 2:27170103-27170125 AGCTGTTGCCACCTTGATAGGGG - Intergenic
928049761 2:27978798-27978820 CACTGGGGCCTACTTGAGGGTGG - Intronic
928181106 2:29069519-29069541 CACTGGGGCCTCCTTGAGGGTGG + Intronic
928665497 2:33547240-33547262 CGCTGGTGCCTCCTTGATGGCGG + Intronic
930365612 2:50435787-50435809 CACTGGGGCCTTCTTGAGGGTGG + Intronic
932166249 2:69510205-69510227 CGCTGGGGCCTCCTTGAAGGTGG - Intronic
932222570 2:70011090-70011112 CACTGGGACCTCCTTGAGGGTGG + Intergenic
932296547 2:70628405-70628427 CACTGTGGCCTCCTTGAGGGTGG - Intronic
932310903 2:70739855-70739877 CACTGGGGCCTACTTGAGGGTGG + Intronic
932511485 2:72297384-72297406 CACTGGGGCCTACTTGAGGGTGG - Intronic
932647445 2:73518123-73518145 CACTGGGGCCTACTTGAGGGTGG - Intronic
933554184 2:83811174-83811196 CGCTGGGGTCTACTTGAGGGTGG + Intergenic
933574695 2:84054275-84054297 CACTGGGGCCTACTTGAGGGTGG - Intergenic
933587813 2:84199160-84199182 CACTGGGGCCTACTTGAGGGTGG - Intergenic
935609485 2:105006200-105006222 CCCTGCTGACACCTTGATGGTGG - Intergenic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
936051724 2:109228983-109229005 CTCTGGTGGCTCCTGGATGAAGG - Intronic
937503222 2:122506397-122506419 CACTGGGGCCTACTTGAGGGTGG + Intergenic
938283442 2:130085398-130085420 CACTGGGGCCTACTTGAGGGAGG + Intronic
938334074 2:130473963-130473985 CACTGGGGCCTACTTGAGGGAGG + Intronic
938355746 2:130646704-130646726 CACTGGGGCCTACTTGAGGGAGG - Intronic
938432167 2:131253493-131253515 CACTGGGGCCTACTTGAGGGAGG - Intronic
938539238 2:132272948-132272970 CGCGGGAGCCTACTTGAGGGAGG - Intergenic
938866695 2:135429368-135429390 CACTGGGGCCTACTTGAGGGTGG + Intronic
939932260 2:148250296-148250318 CACTGGGGCCTACTTGAGGGTGG + Intronic
941541401 2:166790157-166790179 CACTGGTGTCTACTTGAGGGGGG - Intergenic
941993638 2:171580678-171580700 CGCTGGGGCCTACTTGAGGATGG - Intergenic
942868880 2:180711051-180711073 CACTGGGGCCTACTTGAAGGTGG - Intergenic
942869164 2:180714091-180714113 CGATGAAGCCTACTTGATGGTGG - Intergenic
942908554 2:181213068-181213090 CACTGGGGCCTACTTGAGGGAGG + Intergenic
942963989 2:181867144-181867166 CACTGGGGTCTCCTTGATGGGGG + Intergenic
943124462 2:183779424-183779446 CACTGGGGCCTACTTGAGGGTGG - Intergenic
943307292 2:186279332-186279354 CACTGGGGCCTACTTGAGGGCGG - Intergenic
943413868 2:187573737-187573759 CACTGGAGCCTACTTGAAGGTGG - Intergenic
943500821 2:188687444-188687466 CACTGGGGCCTACTTGAGGGTGG - Intergenic
943743585 2:191437790-191437812 CACTGGGGCCTCCTTGAGGTGGG - Intergenic
944085849 2:195847476-195847498 CACTGGGGCCTACTTGAGGGTGG + Intronic
944263821 2:197702645-197702667 CTCTGGGGCCTACTTGAGGGTGG - Intronic
944420363 2:199523624-199523646 TGCTGGAGCCTACTTGAGGGTGG - Intergenic
944546269 2:200802060-200802082 CACTGGGGCCTACTTGAGGGTGG + Intergenic
944604257 2:201336165-201336187 CGGTGGGGCCTACTTGAAGGTGG - Intronic
945031152 2:205664885-205664907 CCCTGGGGCCTGCTTGAGGGTGG - Intergenic
946475575 2:220003721-220003743 TGGTGGTGCATCCTTGCTGGAGG - Intergenic
946700647 2:222409833-222409855 CACTGGGGCCTACTTGGTGGAGG - Intergenic
946770238 2:223081585-223081607 CCCTGGAGCCTACTTGAGGGTGG + Intronic
947327024 2:228990843-228990865 CACTGGGGCCTACTTGAGGGAGG + Intronic
948338653 2:237231462-237231484 AGCTTTTGCCTCTTTGATGGTGG + Intergenic
948343693 2:237277516-237277538 CACTGGAGCCTACTTGAGGGTGG + Intergenic
949054616 2:241921055-241921077 CGCTGGGGCCTACTTGAGGGTGG + Intergenic
1168816639 20:742253-742275 CTGTGTTGCCTCCTTGAAGGTGG - Intergenic
1168962709 20:1879980-1880002 TGCTGGAGCCCCCTGGATGGGGG + Intergenic
1169947596 20:11006027-11006049 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
1170378202 20:15726087-15726109 CACTGGGGCCTACTTGAGGGTGG - Intronic
1171769372 20:29310776-29310798 CGCGGGAGCCTACTTGAGGGAGG - Intergenic
1171868178 20:30505801-30505823 CGCGGGAGCCTACTTGAGGGAGG - Intergenic
1171937799 20:31292602-31292624 CACTGGGGCCTACTTGAGGGCGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172875115 20:38159342-38159364 CACTGGGGCCTCCTTGAGGGTGG + Intronic
1173137535 20:40452560-40452582 CCCTGGGGCCTACTTGAAGGTGG - Intergenic
1174683380 20:52430177-52430199 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1174711410 20:52709579-52709601 CACTGGGGCCTACTTGAAGGTGG + Intergenic
1175614492 20:60383554-60383576 CACTGGGGCCTACTTGATGAAGG - Intergenic
1175668462 20:60880359-60880381 CACTGGGGCCTACTTGAGGGCGG + Intergenic
1175908509 20:62393453-62393475 GGCTGGTGCCGACTTGGTGGGGG + Exonic
1176864775 21:14041015-14041037 CACTGGGGTCTACTTGATGGGGG - Intergenic
1178189197 21:30261074-30261096 CACTGGAGCCTACTTGAGGGTGG + Intergenic
1178760989 21:35402879-35402901 CCCTGCTGACACCTTGATGGTGG - Intronic
1179174511 21:38997962-38997984 CGCTGGGGTCTACTTGAGGGTGG - Intergenic
1180294706 22:10873699-10873721 CTCTGGTGCTTCGTTGATGGGGG + Intergenic
1180340583 22:11614557-11614579 CGCGGGAGCCTACTTGAGGGAGG + Intergenic
1180476253 22:15711407-15711429 CACTGGGGCCTACTTGAGGGTGG - Intronic
1180497512 22:15903113-15903135 CTCTGGTGCTTCGTTGATGGGGG + Intergenic
1181451066 22:23021672-23021694 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1183244992 22:36686552-36686574 TGCTGCTGCCTCTTTGAGGGTGG - Intronic
1183443870 22:37839931-37839953 CCCTGTGGACTCCTTGATGGTGG - Intronic
1184253844 22:43276092-43276114 CGCTGGTGCCCCACTGATGGGGG + Intronic
1184304119 22:43583673-43583695 CTCTGGGGCCTCCTTTATGAAGG - Intronic
1184370712 22:44080321-44080343 CCCTGCTGCCACCTTGATGTTGG - Intronic
1185092635 22:48784631-48784653 CTCCGGTGCCGCCTTCATGGGGG - Intronic
1185138032 22:49084419-49084441 TGCTGGGCCCTCCTTGGTGGTGG + Intergenic
1185231051 22:49683034-49683056 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1185345293 22:50308060-50308082 CGCTCGTGCTTCCTGGACGGCGG - Intergenic
949107635 3:219680-219702 CACTGGGGCCTACTTGAAGGTGG + Intronic
949297769 3:2546480-2546502 CACTGGGGCCTCCTTGAGGGTGG + Intronic
950848438 3:16038047-16038069 CACTGGAGCCTACTTGAGGGTGG - Intergenic
951750846 3:26034759-26034781 CACTGGGGCCTACTGGATGGTGG + Intergenic
952569738 3:34700472-34700494 CACTGGTGCCTACTTGAGGGTGG + Intergenic
952877144 3:37955674-37955696 CACTGGGGCCTACTTGAGGGTGG + Intronic
953333595 3:42074854-42074876 CGATGGGGCCTACTTGAAGGTGG - Intronic
953745222 3:45568797-45568819 CACTGGGGCCTGCTTGAGGGTGG - Intronic
953818803 3:46185997-46186019 CACTGGGGCCTACTTGAAGGTGG - Intronic
953887181 3:46721364-46721386 CACTGGAGCCTACTTGATGGGGG + Intronic
954285672 3:49617405-49617427 CTCTTGTGTCTCCTTTATGGCGG + Intronic
954960303 3:54558575-54558597 CACTGGGGCCTACTTGAGGGTGG - Intronic
955245182 3:57218263-57218285 CACTGGGGCCTGCTTGAGGGTGG - Intronic
955289189 3:57674959-57674981 CACTGGGGTCTACTTGATGGTGG + Intronic
956009179 3:64812432-64812454 TGCTGGGGCCTACTTGAGGGTGG - Intergenic
956057276 3:65313239-65313261 CACTGGAGCCTACTTGATGGTGG - Intergenic
956236110 3:67072677-67072699 CACTGGCGTCTGCTTGATGGTGG - Intergenic
956372384 3:68577417-68577439 CACTGGGGCCTACTTGAGGGTGG + Intergenic
956578025 3:70777430-70777452 CACTGGGGCCTCCTTGAGGGTGG + Intergenic
956737571 3:72249705-72249727 CACTGGAGCCTACTTGAGGGTGG + Intergenic
956854938 3:73266941-73266963 TGCTGGGGCCTACTTGAGGGTGG + Intergenic
957484476 3:80840548-80840570 CACTGGGACCTACTTGATGGAGG + Intergenic
957876085 3:86148439-86148461 CACTGGGGCCTACTTGAAGGTGG + Intergenic
958268118 3:91463964-91463986 CACTGGAGCTTCCTTGAGGGTGG - Intergenic
958542044 3:95490314-95490336 CACTGGGGCCTACTTGATGGTGG - Intergenic
958851337 3:99329566-99329588 CAGTGGTGCCTACTTGAAGGTGG + Intergenic
958875343 3:99609881-99609903 CACTGGGGCCTACTTGAGGGTGG - Intergenic
959035189 3:101354413-101354435 CTCTGGAGCCTACTTGAAGGTGG - Intronic
959825140 3:110785058-110785080 CCCTGGGGCCTACTTGAGGGTGG - Intergenic
960033816 3:113083103-113083125 CACTGGGGCCTCCTTGAGGGTGG + Intergenic
960118370 3:113921069-113921091 CACTGGAGCCTACTTGAGGGTGG - Intronic
960778401 3:121288954-121288976 CACTGGGGCCTACTTGAGGGTGG + Intronic
961341914 3:126229868-126229890 CACTGGGGCCTACTTGAAGGTGG - Intergenic
961417192 3:126767753-126767775 CACTGGGGCCTACTTGAGGGTGG - Intronic
961818083 3:129561517-129561539 GGCTGAGGCCTCCTTGGTGGGGG - Intronic
962002494 3:131312982-131313004 CGCTGGGGCCTACTAGAAGGTGG - Intronic
962832347 3:139155536-139155558 CACTGGGGCCTACTTGAAGGTGG + Intronic
963035035 3:141018809-141018831 CACTGGGGCCTACTTGAGGGTGG + Intergenic
963081796 3:141402115-141402137 GGCCGCTGCCTCCTTGGTGGGGG + Intronic
963674399 3:148290942-148290964 CACTGGGGTCTCCTTGAGGGTGG + Intergenic
963831202 3:150011600-150011622 CACTGGGGCCTACTTGAGGGTGG + Intronic
963993842 3:151684261-151684283 CACTGGGGCCTACTTGAGGGTGG + Intergenic
964193962 3:154040060-154040082 CACTGGGGCCTCCCTGAGGGTGG + Intergenic
964375271 3:156043082-156043104 CACTGGGGCCTCCTTGAAGGTGG - Intronic
964487052 3:157196920-157196942 CACTGGGGTCTACTTGATGGGGG + Intergenic
965742241 3:171887674-171887696 CACTGGTGTCTACTTGAGGGTGG - Intronic
966341797 3:178933315-178933337 CACAGGGGCCTACTTGATGGGGG + Intergenic
967113811 3:186318756-186318778 CGCCGCTGACTCCTTGATTGTGG + Intronic
967480679 3:189969561-189969583 AGCTTGTGGCTCCTTGAGGGAGG - Intronic
968375209 4:34392-34414 CACTGGGGTCTACTTGATGGGGG - Intergenic
970631606 4:17952896-17952918 CACTGGGGCCTACTTGAGGGAGG - Intronic
970653785 4:18207839-18207861 CACTGGAGCCTACTTGATGGTGG - Intergenic
971183468 4:24352027-24352049 CCCTGGCGCCTCCTTGATCTAGG - Intergenic
971305758 4:25479869-25479891 CGCTGGTGCCTACTTAAGGGTGG + Intergenic
971429271 4:26547096-26547118 CACTGAGGCCTACTTGATGGTGG - Intergenic
971798464 4:31258702-31258724 CACTGGGGCCTAGTTGATGGTGG + Intergenic
971829506 4:31672411-31672433 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
972010655 4:34176965-34176987 CACTGGGGCCTACTTGAGGGTGG + Intergenic
972377200 4:38483642-38483664 CACTGGGTCCTCCTTGAGGGTGG - Intergenic
973149711 4:46872306-46872328 CACTGGTGCCTACTTGAGGGTGG + Intronic
973617964 4:52698718-52698740 CACTGGGGCCTACTTGATGTTGG + Intergenic
974528289 4:63074697-63074719 CACTGGTGTCTACTTGAAGGTGG - Intergenic
974621916 4:64367219-64367241 CACTGGAGCCTGCTTGAGGGTGG + Intronic
974623756 4:64395831-64395853 CACTGGGGCCTACTTGAGGGTGG - Intronic
974765991 4:66347261-66347283 CACTGGGGCCTACTTGAGGGTGG + Intergenic
975105624 4:70565625-70565647 CGCTGGGGTCTACTTGACGGTGG - Intergenic
975302319 4:72804859-72804881 CTCTGGTGACTCCTTGATTGGGG - Intergenic
975667778 4:76750497-76750519 CACTGGTGCCTATTTGAGGGTGG + Intronic
977266621 4:94863173-94863195 CACCGGGGCCTACTTGATGGTGG + Intronic
977517775 4:98043929-98043951 CACTGGGGCCTACTTGAGGGTGG - Intronic
977582409 4:98739968-98739990 CGCTGGGGCCTACTTAAGGGTGG - Intergenic
977903619 4:102451173-102451195 CACTGGGGCCTACTTGAGGGTGG + Intergenic
978317996 4:107461431-107461453 CACTGGTGCCTACTTGAGGGTGG + Intergenic
978593261 4:110349712-110349734 CACTGGTGTCTACTTGAGGGTGG - Intergenic
978683256 4:111409171-111409193 CACTGGGGTCTACTTGATGGGGG - Intergenic
978949490 4:114540457-114540479 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
979590602 4:122475266-122475288 CACTGGGGCCTACTTGAGGGTGG - Intergenic
979854614 4:125616299-125616321 CGCTGGGGTCTACTTGATGGGGG - Intergenic
980635864 4:135501951-135501973 CACTGGAGCCTGCTTGAGGGTGG + Intergenic
980669724 4:135988492-135988514 CACTGGGGCCTACTTGAGGGCGG + Intergenic
981079034 4:140619951-140619973 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
981283405 4:142987232-142987254 CACTGGTGTCTCCTTGAGGAGGG - Intergenic
982219109 4:153110018-153110040 CACTGGGGCCTACTTGAGGGTGG + Intergenic
982690515 4:158542942-158542964 CACTGGGGCCTACTTGAGGGTGG + Intronic
985239184 4:187911853-187911875 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
985459834 4:190094652-190094674 CACTGGGGTCTACTTGATGGGGG + Intergenic
986194023 5:5521243-5521265 CACTGGGGCCTCCTGGAGGGTGG + Intergenic
986984844 5:13488839-13488861 CACTGGCGCCTACTTGAGGGTGG - Intergenic
988782041 5:34531066-34531088 CGCTGGGGTCTACTTGATGGGGG + Intergenic
989154611 5:38332443-38332465 CACTGGGGTCTACTTGATGGGGG - Intronic
989999241 5:50873731-50873753 TGCTGGTGCCTTCTTGATCTTGG - Intergenic
990175774 5:53106533-53106555 CACTGGAGCCTACTTGAGGGTGG + Intronic
990354076 5:54948494-54948516 CGCTAGGGCCTACTTGAGGGTGG + Intergenic
990398828 5:55415171-55415193 CACTGGTGCCTACTTGAGGGAGG + Intronic
990611319 5:57459599-57459621 CACTGGGGCCTGCTTGAGGGAGG + Intergenic
990687061 5:58316402-58316424 CACTGGGGCCTACTTGAGGGTGG - Intergenic
990702944 5:58495273-58495295 CACTGGGGCCTACTTGAGGGAGG + Exonic
991455631 5:66800527-66800549 CACTGGGGCCTGCTTGAGGGTGG + Intronic
991499264 5:67259898-67259920 CGCTGGTGCCTCCACCAGGGTGG + Intergenic
991933056 5:71774351-71774373 CACTGGGGCCTACTTGAGGGTGG + Intergenic
992313877 5:75532245-75532267 CACTGGAGCCTACTTGAGGGTGG - Intronic
992593315 5:78318681-78318703 CACTGAGGCCTCCTTGAGGGTGG + Intergenic
992856656 5:80868601-80868623 CACTGGGGCCTACTAGATGGGGG + Intronic
992857998 5:80883612-80883634 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
992921380 5:81525339-81525361 CACTGGGGCCTCCTTGAGGATGG - Intronic
993062407 5:83054668-83054690 CACTGGGGCCTACTTGAGGGTGG + Exonic
993104035 5:83578316-83578338 CACTGGGGCCTACTTGAGGGTGG + Intronic
993362267 5:86992277-86992299 CACTGGGGCCTACTTGAGGGTGG - Intergenic
994397409 5:99236556-99236578 CACTGGGGCCTACTTGAGGGTGG + Intergenic
994433313 5:99696003-99696025 CACTGGGGCCTACTTGAGGGTGG - Intergenic
994656664 5:102602630-102602652 CACTGGAGCCTACTTGAGGGTGG - Intergenic
995269980 5:110208908-110208930 CACTGGGGACTCCTTGAAGGGGG - Intergenic
995622673 5:114043915-114043937 CACTGGGGCCTACTTGAGGGTGG + Intergenic
996081115 5:119259278-119259300 CACTGGGGCCTACTTGAGGGTGG + Intergenic
997043471 5:130285462-130285484 CACTGGAGCCTACTTGAGGGTGG + Intergenic
997045072 5:130306205-130306227 CACTGGTGTCTACTTGAGGGTGG + Intergenic
997099735 5:130955925-130955947 CACTGGGGCCTACTTGAGGGTGG - Intergenic
997913921 5:137904599-137904621 CACTGGGGCCTACTTGATGGAGG + Intronic
998577406 5:143331769-143331791 CACTGGGGCCTACTTGAGGGTGG + Intronic
999807377 5:155095224-155095246 CGCTGGAACCTACTTGAAGGCGG + Intergenic
1000731903 5:164845194-164845216 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1001850973 5:174964836-174964858 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1001940579 5:175736878-175736900 CCCTGGTGCCTCCAGGCTGGGGG + Intergenic
1002317019 5:178349946-178349968 CACTGGTGCCTCATTGTAGGTGG - Intronic
1002582484 5:180217185-180217207 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1003525841 6:6896300-6896322 CAATGGGGTCTCCTTGATGGGGG + Intergenic
1003830392 6:10003667-10003689 CACTGGGGCCTACTTGAAGGTGG + Intronic
1003993052 6:11506850-11506872 CATTGGGGCCTCCTTGAGGGTGG + Intergenic
1004818064 6:19333858-19333880 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1004828112 6:19446114-19446136 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1006073602 6:31515305-31515327 CACTGGGGCCTCCTTGAGGGTGG + Intergenic
1006296385 6:33171842-33171864 GGCTGGTGTCTCCTTCCTGGGGG - Intronic
1007504953 6:42328503-42328525 CACTGGGGCCTGCTTGAGGGTGG - Intronic
1007653040 6:43434872-43434894 CGCTGAAGTCTCCTTGATGCTGG - Intronic
1007869946 6:45023744-45023766 CACTGGGGCCTACTTGAAGGTGG + Intronic
1008779526 6:55086207-55086229 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1008801971 6:55379320-55379342 CACTGGGGTCTCCCTGATGGGGG - Intronic
1008987085 6:57557602-57557624 CACTGGAGCTTCCTTGAGGGTGG + Intronic
1009175043 6:60450169-60450191 CACTGGAGCTTCCTTGAGGGTGG + Intergenic
1009468665 6:64004615-64004637 CACTGGAGCCTACTTGAGGGTGG - Intronic
1010473579 6:76260375-76260397 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1010839562 6:80632740-80632762 CACTGGTGCCTACTTGAGGGTGG + Intergenic
1011102006 6:83732745-83732767 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1011281460 6:85681932-85681954 CACTAGGGCCTCCTTGAGGGTGG - Intergenic
1012179012 6:96127193-96127215 CACTGGGGCCTACTTGAGGGTGG - Intronic
1012250808 6:96978300-96978322 CACTGGGGCCTACTTAATGGTGG - Intronic
1013864451 6:114678469-114678491 CACTGGGGTCTACTTGATGGGGG + Intergenic
1014402389 6:121006641-121006663 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1014613769 6:123577304-123577326 CACTGGGGCCTACTTGAGGGTGG - Intronic
1015288850 6:131515020-131515042 CACTGGGGTCTACTTGATGGGGG - Intergenic
1015474028 6:133638834-133638856 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1015697638 6:135999423-135999445 CACTGGGGCCTACTTGAGGGTGG - Intronic
1016144538 6:140652103-140652125 TGCTGATCTCTCCTTGATGGAGG + Intergenic
1016287922 6:142493952-142493974 CACTGGGGCCTCCCTGAGGGAGG + Intergenic
1016704858 6:147094950-147094972 CACTGGGGCCTACTTGAAGGTGG + Intergenic
1016777939 6:147925840-147925862 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1016980417 6:149848712-149848734 CGCTGGGACCTACTTGAGGGTGG + Intronic
1017261154 6:152389361-152389383 CACTGGTGCCTCCTTGAGGGTGG - Intronic
1017605924 6:156133025-156133047 GACTGGGGCCTCCTTGAGGGTGG + Intergenic
1017762068 6:157577020-157577042 CACTGGGGCCTACTTGAGGGTGG - Intronic
1018771539 6:166975314-166975336 CACTGGGGTCTACTTGATGGGGG - Intergenic
1019031046 6:169012458-169012480 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1019817180 7:3209898-3209920 CACTGGTGTCACCTTGAGGGTGG - Intergenic
1020571115 7:9862994-9863016 CACTGGAGCCTGCTTGAGGGTGG + Intergenic
1020852027 7:13366110-13366132 CACTGGGGACTACTTGATGGGGG - Intergenic
1021336524 7:19409466-19409488 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1021773916 7:24032838-24032860 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1021967709 7:25937899-25937921 CACTGGTGTCTACTTGAGGGTGG + Intergenic
1022075761 7:26968343-26968365 CACTGGGGCCTACTTGAGGGTGG - Intronic
1022228736 7:28392107-28392129 CGCTGGGGCCTACCTGAGGGTGG + Intronic
1023406366 7:39837338-39837360 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1023586657 7:41738076-41738098 CGCTGGGGCCTTGTTGTTGGTGG + Intergenic
1024106264 7:46089994-46090016 CACTGGAGCCTACTTGATAGTGG - Intergenic
1024217729 7:47262215-47262237 CGCTGGGGCCTACTTAAGGGTGG + Intergenic
1024375277 7:48630318-48630340 CACTGGAGCCTACTTGAGGGTGG - Intronic
1025061116 7:55809245-55809267 CACTGGGGCCTCCTTGAGGGTGG + Intronic
1025064874 7:55845077-55845099 CACTGGTGTCTACTTGAGGGTGG - Intronic
1025616963 7:63128387-63128409 CACTGAGGCCTCCTTGAGGGTGG + Intergenic
1026193550 7:68151557-68151579 CACTGGGGCCTCCTTGAGGGTGG + Intergenic
1026274926 7:68868251-68868273 CACTGGAGCCTACTTGAAGGTGG - Intergenic
1026422158 7:70250848-70250870 CACTGGGGCCTACTTGAGGGTGG + Intronic
1027429676 7:78097647-78097669 CACTGGTGTCTACTTGAGGGTGG + Intronic
1028346281 7:89787926-89787948 CACTGGTGCCTACTTGAGGGTGG - Intergenic
1028565764 7:92228748-92228770 TACTGGGGCCTCCTTGAGGGTGG - Intronic
1028640370 7:93035729-93035751 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1028860695 7:95646851-95646873 CACTGGGCCCTCCTTGAGGGTGG - Intergenic
1028881954 7:95890412-95890434 TACTGGGGCCTCCTTGACGGTGG + Intronic
1029054430 7:97726368-97726390 CACTGGTGTCTGCTTGAGGGGGG - Intergenic
1029412370 7:100422737-100422759 CACTGGGGCCTACTTGAGGGTGG - Intronic
1029932550 7:104387948-104387970 CACTGGGGCCTACTTGAGGGTGG - Intronic
1030133883 7:106227532-106227554 CACTGGAGTCTGCTTGATGGGGG - Intergenic
1030349215 7:108464472-108464494 CACTGGGGTCTACTTGATGGGGG + Intergenic
1030807926 7:113938738-113938760 CACTGGTGCCTGCTTGAGGGTGG - Intronic
1031023882 7:116659277-116659299 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1031059256 7:117031171-117031193 CACTGGGGCCTACTTGAAGGAGG + Intronic
1031405466 7:121380533-121380555 CTCTGGGGCCTACTTGAGGGTGG + Intronic
1031911639 7:127523044-127523066 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1033681539 7:143600488-143600510 CCATGGTGACTCCTTGAGGGGGG + Intergenic
1033703353 7:143861325-143861347 CCATGGTGACTCCTTGAGGGGGG - Intronic
1035142298 7:156774999-156775021 CACTGGGGCCTACTTGAAGGTGG + Intronic
1036055048 8:5242627-5242649 CGCTGGGGCCTACTTGAGGGTGG + Intergenic
1036490063 8:9216688-9216710 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1037021439 8:13976692-13976714 CTCTGATGCCTCTTTGATAGAGG - Intergenic
1037253824 8:16928822-16928844 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1037300944 8:17451372-17451394 CCCTGGGGCCTTCTTGAGGGTGG - Intergenic
1037371789 8:18187687-18187709 CACTGGGGCCTACTTGAGGGTGG + Intronic
1037404059 8:18522829-18522851 CACTGGCGCCTGCTTGAGGGTGG - Intergenic
1037898673 8:22675127-22675149 CCTTGCTGCCTCCTTGAAGGAGG + Intergenic
1038714458 8:29979410-29979432 AGCTGATGCAGCCTTGATGGAGG + Intergenic
1038808764 8:30818728-30818750 CACTGGGGGCTCCTAGATGGGGG - Intergenic
1038854333 8:31314684-31314706 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1038920863 8:32082374-32082396 CACTGGGGCCTACTTGAGGGTGG - Intronic
1038949706 8:32401126-32401148 CACTGGGGCCTACTTGAGGGTGG + Intronic
1039737300 8:40346494-40346516 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1041065343 8:54077326-54077348 CACTGGGGCCTACTTGATGGTGG + Intronic
1041162187 8:55056614-55056636 CACTGGGGCCTGCTTGAGGGTGG + Intergenic
1041221396 8:55655164-55655186 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
1041586131 8:59522068-59522090 CACTGAGGCCTCCTTGAGGGTGG + Intergenic
1041655350 8:60344401-60344423 CACTGAGGCCTCCTTGAGGGTGG + Intergenic
1041791871 8:61705229-61705251 CACTGGGGCCTACTTGAGGGTGG + Intronic
1041914041 8:63121698-63121720 CATTGGGGCCTCCTTGAGGGAGG - Intergenic
1043493857 8:80778840-80778862 CACTGGGGCCTACTTGAGGGTGG + Intronic
1044170578 8:89046749-89046771 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1045952905 8:107871888-107871910 CCCTGGAGCCTACTTGAGGGTGG + Intergenic
1046290736 8:112156600-112156622 CACTGGCGCCTACTTGAGGGTGG + Intergenic
1046596476 8:116267040-116267062 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1046722063 8:117631617-117631639 CTCTGGGGCCTACTTGAGGGTGG + Intergenic
1046883340 8:119334724-119334746 CACTGGGGCCTACTTGATTGTGG - Intergenic
1046959621 8:120096530-120096552 CACTGGGGCCTACTTGAAGGTGG - Intronic
1047159103 8:122356551-122356573 CGCTGGGGCCTACTTGAGGGTGG - Intergenic
1047862984 8:128989406-128989428 CACTGGGGACTCCTTGAAGGAGG - Intergenic
1048201145 8:132374683-132374705 CGCTGGGGCCTACTTGAGGGTGG - Intronic
1048452105 8:134542457-134542479 CACTGGGGCCTGCTTGAGGGTGG - Intronic
1050238385 9:3607794-3607816 CACTGGAGCCTACTTGAGGGTGG - Intergenic
1051878733 9:21818134-21818156 AGCTTGTGGCTCCTTGAGGGAGG + Exonic
1051891991 9:21951883-21951905 CACTGGTGCCTACTTGAGGGCGG + Intronic
1052455019 9:28684988-28685010 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1052735471 9:32338031-32338053 CGCTGAGGCCTACTTGAGGGTGG + Intergenic
1055966447 9:81869484-81869506 CACTGGTGCCTACTTGAGGGTGG - Intergenic
1056181374 9:84086165-84086187 CACTGGGGTCTACTTGATGGGGG - Intergenic
1056750067 9:89343501-89343523 CACTGGGGCCTACTTGAGGGTGG - Intronic
1057501829 9:95602441-95602463 CGCTGGTCCCACCTTGAGGCAGG + Intergenic
1057695417 9:97319492-97319514 CACTGGGGCCTACTTGAGGGTGG - Intronic
1058616601 9:106835280-106835302 CACTGGGGCCTACTTGACGGTGG + Intergenic
1059083980 9:111280269-111280291 CGCTGGGGCCACCTTGAGGGTGG - Intergenic
1059515037 9:114885801-114885823 CACTGGGGCCTACTTGAAGGTGG + Intergenic
1060008417 9:120021109-120021131 CACTGGTACCTACTTGAAGGTGG - Intergenic
1060034860 9:120246306-120246328 CACTGGGGCCTACTTGAGGGAGG - Intergenic
1060538810 9:124415346-124415368 CGCAGGTGCCGCCTTGCTTGGGG - Exonic
1060875096 9:127077540-127077562 GGCCGTTGCCCCCTTGATGGGGG + Intronic
1061375930 9:130224591-130224613 CACTGGAGCCTACTTGAGGGTGG + Intronic
1062299166 9:135854927-135854949 CACTGGGGTCTCCTTGAGGGTGG - Intronic
1062431729 9:136529425-136529447 AGCCGGTGCCTCCTGGAAGGTGG - Intronic
1203574015 Un_KI270744v1:159758-159780 CACTGGGGTCTACTTGATGGGGG + Intergenic
1185908621 X:3961413-3961435 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1186001565 X:5017756-5017778 CACTGAGGCCTACTTGATGGTGG - Intergenic
1186012486 X:5150512-5150534 CACTGGGGCCTGCTTGAGGGTGG - Intergenic
1186157061 X:6736836-6736858 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1186616662 X:11195644-11195666 CACTGGAGCCTACTTGAGGGTGG + Intronic
1186890710 X:13956763-13956785 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1187054294 X:15727347-15727369 CACTGGGGCCTACTTGAGGGTGG - Intronic
1187132448 X:16515952-16515974 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1187586789 X:20671768-20671790 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1188014199 X:25090083-25090105 CACTGGCGCCTACTTGAGGGTGG - Intergenic
1188072081 X:25729468-25729490 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1188090605 X:25960051-25960073 CACTGGGGCCTACTTGAAGGTGG - Intergenic
1188289437 X:28369512-28369534 CACTGGGGCCTACCTGATGGTGG - Intergenic
1188757155 X:33976055-33976077 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1188775788 X:34216706-34216728 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1188855178 X:35185943-35185965 CCCTGGAGCCTACTTGAGGGTGG - Intergenic
1188879356 X:35472731-35472753 CGCTGGGGCCTGCTTGAGGGTGG - Intergenic
1189050131 X:37635965-37635987 CACTGGGGCCTACTTGAGGGTGG - Intronic
1189191379 X:39110665-39110687 CACTGGGGCCTGCTTGAGGGAGG + Intergenic
1189532860 X:41904748-41904770 CACTGGGGCCTACTTGAGGGTGG - Intronic
1189584158 X:42440686-42440708 CACTGGGGACTCCTTGAGGGTGG + Intergenic
1189720660 X:43912927-43912949 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1190159296 X:48018744-48018766 CACTGGGGCCTACTTGAAGGTGG + Intronic
1190175009 X:48140973-48140995 CACTGGGGCCTACTTGAAGGTGG + Intergenic
1190384205 X:49868595-49868617 CTCTGACGCCTCCCTGATGGGGG + Intergenic
1190809612 X:53870521-53870543 CACTGGGGCCTCCTTGAGGATGG - Intergenic
1190910963 X:54772332-54772354 CACTGGGGCCTACTTGAGGGTGG + Intronic
1191061554 X:56303014-56303036 CACTGGGGCCTACTTGAGGGCGG - Intergenic
1191632684 X:63339071-63339093 CACTGGAGCCTACTTGAGGGAGG + Intergenic
1191878713 X:65822928-65822950 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1192028241 X:67479079-67479101 CGCTGGAGCCTACTTAAAGGTGG - Intergenic
1192056179 X:67776148-67776170 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1192386262 X:70674057-70674079 CACTGGTGTCTACTTGAGGGTGG - Intronic
1192418189 X:71003489-71003511 CACTGGGGCCTACTTGAGGGAGG - Intergenic
1192690631 X:73359296-73359318 CACTGGGGCCTCCTTGAGGGTGG - Intergenic
1192767180 X:74152659-74152681 CACAGGTGCCTCCTTGAGGGTGG + Intergenic
1193264085 X:79447182-79447204 CACTGGGGTCTACTTGATGGTGG - Intergenic
1193397166 X:80999247-80999269 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1193402227 X:81058982-81059004 CACTGGGGCCTACTTGAAGGTGG - Intergenic
1193609563 X:83612917-83612939 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1193722317 X:85001700-85001722 CACTGGGGCCTACTTGACGGTGG + Intergenic
1193748748 X:85316881-85316903 CTCTGGGGCCTACTTGAGGGTGG - Intronic
1193774581 X:85626488-85626510 CACTGGGGCCTATTTGATGGTGG + Intergenic
1193867000 X:86745422-86745444 CACTGGGGCCTACTTGAGGGTGG - Intronic
1193879432 X:86903153-86903175 CACTGGAGCCTACTTGAGGGTGG + Intergenic
1194126670 X:90026734-90026756 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1194415838 X:93610615-93610637 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1194425604 X:93733659-93733681 CACTGGGGCCTACTTGAGGGTGG - Intergenic
1194593456 X:95830024-95830046 CGCTGGGGTCTGCTTGAGGGTGG - Intergenic
1195412183 X:104579589-104579611 CGCTGGGGCCTACTTGAGGGTGG + Intronic
1195448551 X:104981973-104981995 CACTGGGGCCTACTTGAGGGTGG + Intronic
1195532086 X:105968950-105968972 TGCTGGTGCTTCCTTGTTGCAGG + Intergenic
1195854926 X:109320688-109320710 CACTGGGGCCTCCCTGAGGGTGG - Intergenic
1197045489 X:121992268-121992290 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1197242599 X:124135911-124135933 CACTGGGGCCTACTTGAGGGCGG - Intronic
1197355276 X:125431831-125431853 CACTGGAGTCTACTTGATGGTGG - Intergenic
1197598644 X:128499381-128499403 CACTGGAGCCTACTTGAGGGAGG - Intergenic
1197926155 X:131648532-131648554 CACTGGGGCCTACTTGAGGGAGG - Intergenic
1198842225 X:140870057-140870079 CACTGGGGCCTACTTGAGGGTGG + Intergenic
1199456581 X:148036222-148036244 CGCTGGGGCCTACTTGATGGGGG + Intergenic
1199718018 X:150520385-150520407 CACTGGGGCCTACTTGAGGGAGG + Intergenic
1200227134 X:154424432-154424454 CCCTGGTGCCACCTTGATTTCGG - Intergenic
1201075226 Y:10181628-10181650 CGCGGGAGCCTACTTGAGGGAGG + Intergenic
1201980584 Y:19905235-19905257 CACTGGTACCTTCTTGAGGGTGG - Intergenic