ID: 928667393

View in Genome Browser
Species Human (GRCh38)
Location 2:33563420-33563442
Sequence GCTTCCTAGTGACGCAGAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928667393_928667396 26 Left 928667393 2:33563420-33563442 CCAATTCTGCGTCACTAGGAAGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 928667396 2:33563469-33563491 AATACTTACTTAAATAGCCATGG 0: 1
1: 0
2: 3
3: 24
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928667393 Original CRISPR GCTTCCTAGTGACGCAGAAT TGG (reversed) Exonic