ID: 928672291

View in Genome Browser
Species Human (GRCh38)
Location 2:33613998-33614020
Sequence TGGGCTGCCTGGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928672283_928672291 13 Left 928672283 2:33613962-33613984 CCCACATGAGAAAACATAAGATA No data
Right 928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG No data
928672284_928672291 12 Left 928672284 2:33613963-33613985 CCACATGAGAAAACATAAGATAA No data
Right 928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG No data
928672282_928672291 25 Left 928672282 2:33613950-33613972 CCACTGTTGATGCCCACATGAGA No data
Right 928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928672291 Original CRISPR TGGGCTGCCTGGGGAAAAAC AGG Intergenic
No off target data available for this crispr