ID: 928673458

View in Genome Browser
Species Human (GRCh38)
Location 2:33626309-33626331
Sequence CCTTTAGTGATGCAGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928673458_928673462 26 Left 928673458 2:33626309-33626331 CCTTATACCTGCATCACTAAAGG No data
Right 928673462 2:33626358-33626380 TAACAAGACAATCTATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928673458 Original CRISPR CCTTTAGTGATGCAGGTATA AGG (reversed) Intergenic
No off target data available for this crispr