ID: 928675080

View in Genome Browser
Species Human (GRCh38)
Location 2:33642846-33642868
Sequence CAGTTGACCTTGAATGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928675077_928675080 6 Left 928675077 2:33642817-33642839 CCATGCACATCATAACTTAATGG No data
Right 928675080 2:33642846-33642868 CAGTTGACCTTGAATGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928675080 Original CRISPR CAGTTGACCTTGAATGATGT GGG Intergenic
No off target data available for this crispr