ID: 928676629

View in Genome Browser
Species Human (GRCh38)
Location 2:33657541-33657563
Sequence CGGCAAACAGCAGTGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928676629_928676638 24 Left 928676629 2:33657541-33657563 CCATCTACCACTGCTGTTTGCCG No data
Right 928676638 2:33657588-33657610 TCACCCCTCCGGATCTGGCAGGG No data
928676629_928676635 13 Left 928676629 2:33657541-33657563 CCATCTACCACTGCTGTTTGCCG No data
Right 928676635 2:33657577-33657599 GCTGCTGACTTTCACCCCTCCGG No data
928676629_928676637 23 Left 928676629 2:33657541-33657563 CCATCTACCACTGCTGTTTGCCG No data
Right 928676637 2:33657587-33657609 TTCACCCCTCCGGATCTGGCAGG No data
928676629_928676636 19 Left 928676629 2:33657541-33657563 CCATCTACCACTGCTGTTTGCCG No data
Right 928676636 2:33657583-33657605 GACTTTCACCCCTCCGGATCTGG 0: 4
1: 35
2: 86
3: 118
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928676629 Original CRISPR CGGCAAACAGCAGTGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr