ID: 928682616

View in Genome Browser
Species Human (GRCh38)
Location 2:33717821-33717843
Sequence TGTTCTCTGCACACTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928682616_928682626 19 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682626 2:33717863-33717885 AAGCAGGGAGGCTATTTAGGAGG No data
928682616_928682622 3 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682622 2:33717847-33717869 GGTAGGCTCAGAATGGAAGCAGG No data
928682616_928682624 7 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682624 2:33717851-33717873 GGCTCAGAATGGAAGCAGGGAGG No data
928682616_928682621 -4 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682621 2:33717840-33717862 AACATTGGGTAGGCTCAGAATGG No data
928682616_928682623 4 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682623 2:33717848-33717870 GTAGGCTCAGAATGGAAGCAGGG No data
928682616_928682625 16 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682625 2:33717860-33717882 TGGAAGCAGGGAGGCTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928682616 Original CRISPR TGTTCTCTGCACACTGCAGG TGG (reversed) Intergenic
No off target data available for this crispr