ID: 928682622

View in Genome Browser
Species Human (GRCh38)
Location 2:33717847-33717869
Sequence GGTAGGCTCAGAATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928682616_928682622 3 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682622 2:33717847-33717869 GGTAGGCTCAGAATGGAAGCAGG No data
928682617_928682622 0 Left 928682617 2:33717824-33717846 CCTGCAGTGTGCAGAGAACATTG No data
Right 928682622 2:33717847-33717869 GGTAGGCTCAGAATGGAAGCAGG No data
928682615_928682622 13 Left 928682615 2:33717811-33717833 CCACATCACTCCACCTGCAGTGT No data
Right 928682622 2:33717847-33717869 GGTAGGCTCAGAATGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928682622 Original CRISPR GGTAGGCTCAGAATGGAAGC AGG Intergenic
No off target data available for this crispr