ID: 928682624

View in Genome Browser
Species Human (GRCh38)
Location 2:33717851-33717873
Sequence GGCTCAGAATGGAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928682616_928682624 7 Left 928682616 2:33717821-33717843 CCACCTGCAGTGTGCAGAGAACA No data
Right 928682624 2:33717851-33717873 GGCTCAGAATGGAAGCAGGGAGG No data
928682615_928682624 17 Left 928682615 2:33717811-33717833 CCACATCACTCCACCTGCAGTGT No data
Right 928682624 2:33717851-33717873 GGCTCAGAATGGAAGCAGGGAGG No data
928682617_928682624 4 Left 928682617 2:33717824-33717846 CCTGCAGTGTGCAGAGAACATTG No data
Right 928682624 2:33717851-33717873 GGCTCAGAATGGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928682624 Original CRISPR GGCTCAGAATGGAAGCAGGG AGG Intergenic
No off target data available for this crispr