ID: 928683677

View in Genome Browser
Species Human (GRCh38)
Location 2:33727473-33727495
Sequence CACCTTCAGCAGCCCCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928683675_928683677 -7 Left 928683675 2:33727457-33727479 CCACGAAGGTCTCCAGCACCTTC 0: 1
1: 0
2: 1
3: 10
4: 171
Right 928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG 0: 1
1: 0
2: 4
3: 36
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928683677 Original CRISPR CACCTTCAGCAGCCCCAGCT CGG Intergenic
900197598 1:1384841-1384863 CACGTTCTGTGGCCCCAGCTTGG + Intergenic
900244021 1:1629510-1629532 CAGCACCAGCAGCGCCAGCTCGG - Exonic
900341171 1:2190009-2190031 CAGCTTCCCCACCCCCAGCTCGG - Intronic
900514251 1:3073814-3073836 CCCCTTCTAGAGCCCCAGCTTGG + Intronic
900617902 1:3573524-3573546 AGCCTGCAGCAGCCCCAGCCTGG - Intronic
901068521 1:6506075-6506097 CACCGTCCCCAGCTCCAGCTCGG + Intronic
901816113 1:11794445-11794467 CATCTTCAGCAGCTCCTCCTTGG + Exonic
902445310 1:16459525-16459547 TCCCTTCAGAGGCCCCAGCTGGG - Exonic
904274071 1:29369112-29369134 CCCCTTCAGACCCCCCAGCTTGG + Intergenic
904286526 1:29456237-29456259 CACCTGCAGCAGCTCCAGCCAGG - Intergenic
904795811 1:33055590-33055612 TACCCTCTGCAGCCCCAGCCTGG + Intronic
905011898 1:34753063-34753085 CACCTTGTTCAGCCACAGCTGGG - Intronic
905581280 1:39084193-39084215 CTCCTGCAGCAGCCCCCGCCTGG + Exonic
905651720 1:39661228-39661250 CACCATCTTCAGCCCCAGCAGGG - Exonic
906658578 1:47566338-47566360 AACCTTCAGCTGCCCCTGGTAGG + Intergenic
906745198 1:48216595-48216617 GCCCTGCAGCAGCCCTAGCTGGG - Intergenic
907280577 1:53344427-53344449 CAGCTTCAGCAGCCTCATCTAGG + Intergenic
907905744 1:58782858-58782880 CAGCTTGAGCAGCCCCACGTCGG + Exonic
908028178 1:59972535-59972557 CACCTTCTGCTGCCCCTGTTGGG - Intergenic
908655852 1:66388105-66388127 CACCTACAGCTGCCCAGGCTTGG + Intergenic
914515598 1:148371460-148371482 CACCTTTAGAAACACCAGCTGGG - Intergenic
915234738 1:154472454-154472476 CACCTTCATCAGAACCATCTGGG - Intronic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
915835517 1:159172414-159172436 CCCCTTCAGCAGCCTCACCCAGG - Intronic
915885075 1:159713500-159713522 TACCTTCAGGACCCACAGCTGGG + Exonic
917545918 1:175967524-175967546 AACTTACAGCAGCCACAGCTGGG - Intronic
918423712 1:184387533-184387555 CACCAGCAGCAGCCCCGGCCCGG - Intronic
919765888 1:201127185-201127207 CACCTTCAGCAGCCTCTGGCCGG + Intergenic
920104098 1:203538354-203538376 CGCCTTCAGCAGAGGCAGCTTGG - Intergenic
920783015 1:209012871-209012893 CTCCTTCAGGAGAACCAGCTTGG - Intergenic
921123463 1:212156811-212156833 CACAGACAGCAGCCCCAGCAGGG - Intergenic
921176036 1:212595415-212595437 TGCCTCCAGCAGCCCCAGCCCGG + Intronic
921759710 1:218899000-218899022 CACCTACAGCAGGACCAGCTGGG - Intergenic
922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG + Intronic
1064327173 10:14362388-14362410 TAGCTTCTGCAGCCCCAGCTGGG - Intronic
1064417150 10:15159830-15159852 CACCTCTAGGAGCCACAGCTTGG + Intronic
1065023039 10:21516705-21516727 CACCGGCCGCAGCCCCATCTGGG - Exonic
1065521705 10:26579835-26579857 CACCCTCAGCTGGCCCTGCTTGG - Intergenic
1067225569 10:44373808-44373830 CACCTCCAGCAGTCCCACCTGGG - Intronic
1067832637 10:49619212-49619234 CAGATTCTGGAGCCCCAGCTGGG + Intronic
1069653232 10:70066827-70066849 CACCTGGAGCAGTCTCAGCTGGG - Intronic
1070399414 10:76040240-76040262 GACTCCCAGCAGCCCCAGCTGGG - Intronic
1071298128 10:84237395-84237417 CAGGTCCAGCAGCCGCAGCTTGG + Exonic
1073757732 10:106598811-106598833 CACCTGCAGAAGCCCCTGATTGG + Intronic
1075414493 10:122252440-122252462 CACCGTTAGCAGCCCCAGCAGGG + Intronic
1075584298 10:123645963-123645985 CAGGTTCAGGAGCCCCAGCATGG + Intergenic
1075745622 10:124725322-124725344 CACCTCCAGCAGCCCCGGCTGGG + Intronic
1076062987 10:127427958-127427980 CACCTGCAGCAGCTCCCGCTGGG - Intronic
1076424031 10:130354762-130354784 TGCCTTCACCAGCACCAGCTGGG + Intergenic
1076830121 10:132989983-132990005 CGCCCTCAGCAGCCCTAGCCCGG + Intergenic
1076884448 10:133255370-133255392 GACCCTCAGCAGCCCCAGTTAGG + Intergenic
1076946810 10:133657199-133657221 CACATCCAGCAGCACCATCTTGG + Intergenic
1077094057 11:791927-791949 GTCCTGCAGCAGCCCCAGCAGGG + Exonic
1077173031 11:1176791-1176813 CGCCACCAGCAGCCCCAGCCAGG + Intronic
1078107606 11:8368444-8368466 CACCCTCAGCAGACCCAGGATGG + Intergenic
1078315290 11:10289269-10289291 CAGCTGCAGCTGCCCAAGCTGGG - Intronic
1079022214 11:16918425-16918447 CAACTGAAGCAGCCCAAGCTGGG + Intronic
1080363285 11:31542259-31542281 GACCTTCAGGAGACACAGCTAGG + Intronic
1080392513 11:31861320-31861342 CACCTTCATCTTCCCCAGGTGGG - Intronic
1080937683 11:36881303-36881325 CAACTGCAGCTGCCACAGCTCGG - Intergenic
1081811101 11:45914504-45914526 CACCTTCCCCTGCCCCAGCCTGG - Intronic
1082081875 11:48018708-48018730 CACATTCCGCACCCCCAGTTCGG - Intronic
1083137308 11:60691514-60691536 CACCCAGAGCAGCCTCAGCTGGG + Intergenic
1083200740 11:61119604-61119626 CACCTTCTGCTGCCCTAGGTGGG + Intronic
1083470552 11:62881214-62881236 CACCTTCAGCAGCTCCTCCTTGG - Exonic
1083773816 11:64883431-64883453 CAGCCTCATCAGCCCCAGCAAGG - Intronic
1084893810 11:72250839-72250861 CTCCTTGTGCAGCCCCACCTGGG - Intergenic
1084970613 11:72769800-72769822 TACCAGCAGCAGCCCCAGTTCGG + Intronic
1085122072 11:73973685-73973707 CACCTGCCCCTGCCCCAGCTAGG - Intergenic
1085405637 11:76260199-76260221 CCCCTGCATCAGCCCGAGCTGGG + Intergenic
1087083589 11:94195061-94195083 CACCTTCTGCCACCCCAGCCAGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089317521 11:117602095-117602117 CAGAATCAGCAGCCTCAGCTGGG + Intronic
1089530706 11:119127059-119127081 CACCTGCAGCAGCACCTGCATGG + Exonic
1090420596 11:126572584-126572606 CTCCATCAGCAGCACCTGCTTGG - Intronic
1091381911 12:67240-67262 CTCCTGGAGCAGCCCCAGCGGGG + Exonic
1092861729 12:12724844-12724866 CCCCTTCCCCACCCCCAGCTGGG - Intergenic
1094535189 12:31314899-31314921 CACCTTTAGAAACCCCAGCTGGG - Intronic
1095089077 12:38087363-38087385 CACATCCAGCAGCACCATCTCGG - Intergenic
1095821695 12:46485766-46485788 CATCTTCATCAGCCTCAGCCAGG + Intergenic
1097190349 12:57216666-57216688 CACCTTCGGTGCCCCCAGCTGGG + Intergenic
1097269265 12:57764398-57764420 CGCCTTCAGCAGGGGCAGCTGGG + Exonic
1100350063 12:93772809-93772831 CACGATCAGCAGGCCTAGCTAGG - Intronic
1102177095 12:110884093-110884115 CAGCTTCAGCAGCCGGAGGTGGG - Exonic
1102481521 12:113227131-113227153 CTCCTTCCACACCCCCAGCTTGG + Intronic
1103846130 12:123903065-123903087 CAGCTTCTGCAGTTCCAGCTTGG - Exonic
1103955931 12:124576878-124576900 CACATGCAGCAGGCCCAGCCAGG - Intergenic
1104976513 12:132554324-132554346 CACCCTCAGGAGGCCCAGCTGGG + Intronic
1105423448 13:20273049-20273071 CTCCTTCAGCAGGCCCGGCTGGG - Intergenic
1106547663 13:30744513-30744535 CACCTTCAGAAGCCACAGGCAGG + Intronic
1107286846 13:38802704-38802726 AGCCTTCAGCAGCTACAGCTTGG - Intronic
1112179987 13:97069076-97069098 GACTTTCAGCAGCCACAGCCTGG + Intergenic
1113037120 13:106062413-106062435 CACCCTCAGCAGCTCTAGCCAGG + Intergenic
1113657627 13:112078282-112078304 CAGCAACAGCAGCCTCAGCTGGG - Intergenic
1113763547 13:112866623-112866645 CCTCTTCAGCAGCCCCTTCTGGG + Intronic
1114044379 14:18709519-18709541 CAGCTTTGGAAGCCCCAGCTTGG + Intergenic
1114048663 14:18899969-18899991 CAGCTTTGGAAGCCCCAGCTTGG + Intergenic
1114113851 14:19501677-19501699 CAGCTTTGGAAGCCCCAGCTTGG - Intergenic
1114115550 14:19619428-19619450 CAGCTTTGGAAGCCCCAGCTTGG - Intergenic
1115875634 14:37858166-37858188 CACTTTCAGCTTCCCCTGCTTGG + Intronic
1118752632 14:68817779-68817801 CACCTTGAGGAACCCCAGCCAGG + Intergenic
1119330260 14:73787817-73787839 ACCATTCTGCAGCCCCAGCTTGG - Intronic
1121315983 14:92961255-92961277 CACCCTCAGGAGCCACACCTGGG - Intronic
1122618883 14:103041798-103041820 CTCCTTCAGCCGCCGCACCTTGG - Intronic
1122796026 14:104206663-104206685 CACCTCCAGCAGCTCCTGATGGG + Intergenic
1122887011 14:104714650-104714672 CCCCTGCAGCAGGCCCAGGTGGG + Exonic
1125578235 15:40769162-40769184 CGGCTGCAGCAGTCCCAGCTAGG + Intronic
1125728870 15:41881975-41881997 CTCCTCCAGCCGCCGCAGCTCGG + Exonic
1126183650 15:45810268-45810290 CACCTCCAGCGGCCGCAGCATGG + Intergenic
1126800895 15:52295655-52295677 CACGTTCGGCAGCCCCGGCCTGG - Exonic
1127292359 15:57581906-57581928 CACCATCAGCCCCCGCAGCTGGG + Intergenic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127676639 15:61245669-61245691 CACCATCAGCAGCAGCACCTGGG - Intergenic
1128665941 15:69538577-69538599 CACCCTCAGCAGGGCCAGCCGGG + Intergenic
1129231116 15:74197663-74197685 CCCCTTCACCAGCCCCAGTGGGG + Intronic
1130030388 15:80308439-80308461 GAACTTCAGCAGCTCCAGCCAGG - Intergenic
1131189650 15:90303815-90303837 CACCTCCTGCCGCCCCAGCCAGG - Intronic
1131537858 15:93252530-93252552 GACCTCCAGCAGCTCCAGGTTGG - Intergenic
1131583714 15:93671483-93671505 CACCTGCAGCCGTCCCACCTGGG + Intergenic
1132368502 15:101276538-101276560 AACCCACAGCAGCCGCAGCTCGG + Exonic
1132468466 16:88852-88874 GACCCTCACCAGCCCCAGCATGG - Exonic
1132537286 16:488778-488800 CACCTTCCACACCCTCAGCTCGG + Intronic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1132858984 16:2060796-2060818 CTCCTTCAGCAGCTCCAGGTGGG + Exonic
1133216756 16:4297235-4297257 CCCCAGCTGCAGCCCCAGCTGGG + Intergenic
1133981438 16:10635835-10635857 CACCTTCAGCGGGCCCTCCTTGG + Exonic
1134104411 16:11475777-11475799 CACCTTGAGCTGCCAGAGCTTGG + Intronic
1134111673 16:11518914-11518936 CTCCTTCAGAAGCTCCACCTTGG + Exonic
1134290962 16:12902576-12902598 CGCTTTCTCCAGCCCCAGCTTGG - Exonic
1136369254 16:29825724-29825746 CACCATCTGCCGCCCCAGCTGGG - Intronic
1136460456 16:30407401-30407423 CACCTGGAGCCGCCCCAGCCCGG - Exonic
1136506878 16:30710077-30710099 CACCTTCTTCAGGCCCATCTCGG - Exonic
1137268122 16:46885008-46885030 AAACCGCAGCAGCCCCAGCTGGG + Intronic
1137418810 16:48312653-48312675 CACCATCATCCACCCCAGCTAGG - Intronic
1137578755 16:49621021-49621043 CTCCTTCAGCAGCCCCCCCGGGG + Intronic
1137717371 16:50606520-50606542 CAGCTTCAGCACTCCCTGCTCGG - Intronic
1138303058 16:55948715-55948737 CACCATCACCATCCCTAGCTTGG - Intronic
1138386721 16:56640518-56640540 CACCTTCAACACCACCAGCCAGG + Intronic
1138390349 16:56666092-56666114 CACCTTCAGCAGCACAGGCCAGG - Intronic
1138391305 16:56671757-56671779 CACCTTCAGCAGCACAGGCCAGG + Intronic
1139103946 16:63802814-63802836 CACCCCCAGCAACCCCAGCATGG - Intergenic
1139476219 16:67203762-67203784 CAGCTCCAGCAGACGCAGCTTGG - Exonic
1140468824 16:75203671-75203693 CACCTTCTGCATCCACTGCTGGG - Intergenic
1141502205 16:84451942-84451964 AAACGTCAGCCGCCCCAGCTCGG - Exonic
1141676162 16:85518497-85518519 CCCCTTCAGCAGCCCAGCCTTGG - Intergenic
1142130485 16:88429621-88429643 CTCCCTCAGCAGCGCCAGCCTGG + Exonic
1142193362 16:88728035-88728057 AACCTGCAGCAACCACAGCTGGG + Intronic
1142414080 16:89931970-89931992 ACCCTTCTGCAGACCCAGCTGGG + Intronic
1142596524 17:1032276-1032298 CACCTTCCTCAGAGCCAGCTTGG + Intronic
1142610901 17:1108876-1108898 CACCTTCGGCAGCGCCGGCCCGG + Intronic
1142848330 17:2692568-2692590 CACGTCCAGCAGCGCCATCTCGG + Exonic
1143464785 17:7129473-7129495 CACCTGCAGCAGCGCCACCCCGG + Intergenic
1143518821 17:7434087-7434109 CTCCTTCAGCAACCAGAGCTGGG - Intergenic
1143994599 17:10995825-10995847 CACCCACAGCAGCCACAGCTGGG + Intergenic
1144444489 17:15314503-15314525 CAGGATCTGCAGCCCCAGCTGGG + Intronic
1145973570 17:28971264-28971286 CAGCATCAGCAGCCTCACCTGGG + Intronic
1146022152 17:29289025-29289047 CTCCCTCAGCTCCCCCAGCTGGG - Intronic
1146482754 17:33218246-33218268 CACCATCAGAAGCCCCACCCAGG - Intronic
1146926615 17:36750109-36750131 CAGCTTCATTAGCCCCCGCTAGG + Intergenic
1147539184 17:41342777-41342799 CACCTGCAGCAGGCTCAGCGAGG + Intergenic
1148240894 17:45998808-45998830 CGCCTCCAGAAGCCCCATCTTGG + Intronic
1148242000 17:46005734-46005756 CTCCTTCCGCAGCTCCAGCCTGG + Intronic
1148698024 17:49572816-49572838 CACCTTCATCAGCATCACCTGGG + Intergenic
1148863263 17:50615495-50615517 CACTACCAGCAGCCCCAGGTAGG + Exonic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150983430 17:70169269-70169291 CACCTGCTGCTGTCCCAGCTGGG + Intronic
1151088405 17:71407480-71407502 CACCTGCACCAGCCCCAGTTTGG - Intergenic
1151766237 17:76134894-76134916 GACTTTCAGCAGGCCAAGCTGGG - Intergenic
1151907159 17:77056177-77056199 CGCCCTCAGCAGCCCAAGCCGGG + Intergenic
1152004574 17:77672035-77672057 CACCTCCAGCACCCCCACCCTGG + Intergenic
1152186016 17:78856655-78856677 CACCTTCCACAGCCACATCTAGG + Intronic
1152244847 17:79179938-79179960 CACCTCCAGGAGCCCCACTTGGG - Intronic
1152437833 17:80286932-80286954 CACCCTCAGCAGGCACAGCCAGG - Intronic
1152755795 17:82086506-82086528 CACCATCTTCAGCCCCTGCTGGG + Exonic
1153273733 18:3348379-3348401 CAACTCCAGCAGCCCCAGCTGGG - Intergenic
1153545325 18:6199216-6199238 CACCTTAAGAAGCCCCATGTAGG - Intronic
1155166605 18:23237279-23237301 CACCGTCAGTTGCCCCACCTGGG + Intronic
1155691850 18:28634430-28634452 AACCTTTAGCTGCCCCATCTTGG + Intergenic
1157541615 18:48514921-48514943 CACCTGCAGCTGGCCCAGCGTGG + Intergenic
1157617535 18:48996027-48996049 CAGTTTCAGCAGCTCTAGCTTGG + Intergenic
1159068371 18:63594400-63594422 CATGTTCACCAGCACCAGCTTGG - Exonic
1159410420 18:68067681-68067703 CATCTTGATCAACCCCAGCTGGG - Intergenic
1161313540 19:3607549-3607571 CTCCTTCCCCAGCCCGAGCTGGG - Intergenic
1161771002 19:6230602-6230624 CACCTTCAACAACCCCACCACGG - Exonic
1162019862 19:7863419-7863441 GCCCTTCAGCAGCCGCACCTGGG - Exonic
1162783902 19:13022400-13022422 CTCCTTCAGCAGCCAGACCTGGG + Intronic
1162944028 19:14031673-14031695 CCCCTCAAGCAGCCCCAGCCGGG + Intergenic
1163054263 19:14706452-14706474 CACCTTCCCCAGCCCCTGCCTGG + Intronic
1163595593 19:18219366-18219388 CACCTTGGGCAGCTCCACCTCGG + Exonic
1163607023 19:18281191-18281213 CAGCTTCAGCAGCCCCAGGTCGG + Exonic
1163642718 19:18470551-18470573 CACTTCCATCAGCCCCAGTTGGG - Intronic
1163795174 19:19333850-19333872 CACAAGCAGCAGCCCCAGCCTGG - Intronic
1164037596 19:21467984-21468006 CACATCCAGCAGCACCATCTTGG - Intronic
1165366517 19:35370880-35370902 CTCCTTGCGCAGCCTCAGCTGGG - Intergenic
1165746999 19:38235491-38235513 CTCCTTCAGAAGCCCAGGCTGGG - Intergenic
1165761092 19:38321449-38321471 CCAATTCAGCAGCCCCAGCTAGG + Intronic
1166054197 19:40278940-40278962 GTCACTCAGCAGCCCCAGCTGGG + Intronic
1167049312 19:47068930-47068952 GACATGCAGCAGCCCCAGCCCGG + Intronic
1167881353 19:52461074-52461096 GTCCATCAGCAGCTCCAGCTAGG + Intronic
1168057975 19:53874041-53874063 CACCTTCAGCAGCCCGGGTACGG - Exonic
1168078532 19:53993113-53993135 CGCCTTCCACAGCCCCAGGTGGG - Exonic
1168245740 19:55112483-55112505 CGCCTTCAGCAGCCCCTCCATGG + Exonic
925412831 2:3649859-3649881 CACAGACAGCGGCCCCAGCTGGG + Intergenic
926133307 2:10319121-10319143 CACCTCCTGCTGCCCCAGCACGG + Intronic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
929172683 2:38947500-38947522 CCACCTCAGCATCCCCAGCTGGG + Intronic
929770260 2:44885851-44885873 CAGCTGTAGCAGCCCCAGCCTGG + Intergenic
929918412 2:46155062-46155084 CACCTTCCACAGCTCCTGCTGGG - Intronic
929958809 2:46480592-46480614 CACCTTCTCCAGCTCCATCTCGG - Exonic
931187437 2:59967217-59967239 CACCTTCATTACCCTCAGCTGGG - Intergenic
934758333 2:96839727-96839749 CGCGTTCCGCACCCCCAGCTCGG + Exonic
935845332 2:107159957-107159979 CACCTTCAGCATCATCACCTGGG - Intergenic
938100366 2:128493821-128493843 CACCATCAGCAGCAACACCTTGG + Intergenic
938426028 2:131188477-131188499 CAGCTTTGGAAGCCCCAGCTTGG + Intronic
942345581 2:174999429-174999451 CACCCTCACCAGCCCCAGCAAGG + Intronic
942396091 2:175551205-175551227 CACCTTCAGTATCCCCAGGATGG + Intergenic
942552210 2:177131135-177131157 AACCGTCAGCAGCTGCAGCTTGG - Intergenic
945019544 2:205557234-205557256 CACATTATGCAGCACCAGCTGGG + Intronic
945298301 2:208192628-208192650 CAGCTGCAGCAGCCTCAGCTGGG - Intergenic
946049911 2:216853939-216853961 CAGCAACATCAGCCCCAGCTGGG + Intergenic
946242115 2:218362799-218362821 CACCCTGAGCAGCACCAGGTTGG - Exonic
946837598 2:223787886-223787908 CAGTGTCAGCAGCCCCTGCTTGG - Intronic
947815683 2:233034745-233034767 CAGCTTCCCCAGCCCCCGCTCGG + Exonic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
948841391 2:240651333-240651355 CACCTGCAGCACGGCCAGCTGGG - Intergenic
948925219 2:241091895-241091917 CACCTTCAGGAACTGCAGCTTGG - Exonic
1168894373 20:1313346-1313368 GACCTTCCGCAGCCTCAGCCCGG + Exonic
1170690428 20:18610351-18610373 CACCGTCTGTAGTCCCAGCTTGG - Intronic
1173182617 20:40816098-40816120 AAACTTCAGCAGCCCCTCCTGGG - Intergenic
1173390338 20:42626590-42626612 TGCCTTGACCAGCCCCAGCTAGG + Intronic
1174766094 20:53255395-53255417 CTCCTTCAGGGGACCCAGCTCGG - Exonic
1175381754 20:58568599-58568621 CTCCTGCAGCAGCACCAGCAGGG - Intergenic
1175756504 20:61533541-61533563 TACCTCCAGCAGCCCCGGCCAGG - Intronic
1176068711 20:63215236-63215258 CTCCTAGAGCAGCCCCTGCTGGG + Intronic
1176090611 20:63316726-63316748 AATCTTCAGCGGCCCCAGCCTGG - Intronic
1176120253 20:63451272-63451294 CACCTGCAGCAGCCCAGGCCAGG + Intronic
1176229887 20:64027079-64027101 CCCCTTCATCATCCACAGCTTGG - Exonic
1176283291 20:64327593-64327615 CTCCTGGAGCAGCCCCAGCGGGG - Intergenic
1176390567 21:6161041-6161063 TCCCTCCAGCAGCCCCAGGTAGG - Intergenic
1177974358 21:27828763-27828785 CATCTTCAGTAGGCCCAGCCCGG + Intergenic
1178611465 21:34085710-34085732 CTCCTGCCTCAGCCCCAGCTGGG + Intronic
1179490490 21:41738139-41738161 CACCTCCAGCACCCACATCTTGG + Intergenic
1179625814 21:42649160-42649182 CCCCTGCACCACCCCCAGCTCGG + Intergenic
1179732900 21:43377198-43377220 TCCCTCCAGCAGCCCCAGGTAGG + Intergenic
1180127286 21:45801119-45801141 CACCTGCAGCACCCACAGCCTGG + Intronic
1180179064 21:46109869-46109891 CAGTTTCAGCTGCCCCAACTGGG - Intronic
1180410444 22:12602136-12602158 CACCGTCAGCACCCCCGCCTCGG + Intergenic
1180467198 22:15622630-15622652 CAGCTTTGGAAGCCCCAGCTTGG + Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1180841281 22:18960016-18960038 CACCTCCCTCAGCCTCAGCTGGG - Intergenic
1181021850 22:20107682-20107704 CACCTTCAGCATCTCCTGCCTGG - Intronic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181521424 22:23450678-23450700 AACCTCCAGCAGCACCCGCTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1182153639 22:28048977-28048999 CACCTCCAGCAGCACCTACTAGG + Intronic
1182234909 22:28867499-28867521 CACCTTCAGCAGGTCCCTCTTGG - Intergenic
1183670691 22:39270684-39270706 CCCCTTCTCCAGCCCCAGCAAGG + Intergenic
1183691061 22:39388671-39388693 CAGCCCCAGCAGCCCCGGCTTGG - Intergenic
1184342182 22:43891995-43892017 CACCAGCACCAGCCCCAGCCCGG - Exonic
1184401880 22:44279215-44279237 CGCCTTCTTGAGCCCCAGCTGGG + Intronic
1184405381 22:44297948-44297970 CCCCTGCAGCAGCCCCGGGTGGG - Intronic
1184743452 22:46442498-46442520 AGCCTTCAGGAGCCACAGCTGGG - Intronic
1184851908 22:47125829-47125851 CTGCTCCAGGAGCCCCAGCTGGG - Intronic
1185200653 22:49502251-49502273 CAGCTTCACCTCCCCCAGCTGGG + Intronic
1185347585 22:50317163-50317185 CCCCTCCTGCAGCCCCACCTGGG - Intronic
950139816 3:10607709-10607731 CACCTACAGCAGGCTTAGCTTGG - Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950486897 3:13279129-13279151 GAACTTCAGCAGGCCCAGCTGGG - Intergenic
951924062 3:27887873-27887895 CACCTGCAGCAGAACCGGCTAGG + Intergenic
953024536 3:39137287-39137309 GCCCTGCAGCAGCCGCAGCTGGG - Exonic
953239643 3:41137425-41137447 CCCCATCAAGAGCCCCAGCTGGG - Intergenic
954121411 3:48502349-48502371 CACCTGCTGCAGGCCCAGCGCGG - Intronic
954691870 3:52399983-52400005 CTCCCTCAGCAGGCCCACCTTGG + Intronic
954745705 3:52786441-52786463 CACCTGCAGCTGCCCCAGGTGGG + Intronic
954878909 3:53820909-53820931 CGCCTTCAGCAGGCACTGCTTGG + Intronic
955228203 3:57078439-57078461 CACTATCAGCAGCCCCATCACGG - Intronic
955365425 3:58306321-58306343 CCCCGGCAGCAGCCACAGCTGGG - Exonic
956738462 3:72256845-72256867 CATCTCCAGCAGCACCAGCAAGG - Intergenic
964962423 3:162443932-162443954 CATTTTCAGAAGCCCCACCTAGG + Intergenic
967197429 3:187040827-187040849 CAACTTCAGCAGCCCAAGATAGG + Intronic
967874544 3:194258169-194258191 CAACATCAGGAGGCCCAGCTGGG - Intergenic
968058139 3:195708759-195708781 CACCATCTGCAGCACCATCTTGG - Intergenic
968660788 4:1797980-1798002 CTCCTTCTTCAGACCCAGCTGGG - Intronic
968664667 4:1814645-1814667 CGCCGTCAGTCGCCCCAGCTGGG + Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969337024 4:6517078-6517100 CCCCTTCACCAGCCCCAGGCGGG + Intronic
969617639 4:8262812-8262834 CACCAGCAGCACCCACAGCTGGG + Intergenic
971824651 4:31605262-31605284 CACCTTTAGGAACCCCAACTGGG + Intergenic
972670975 4:41214057-41214079 TTCCCTCAGCAGCCCCGGCTTGG - Intronic
974913235 4:68148556-68148578 GAACTTCAGCAACTCCAGCTAGG - Intergenic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
976447790 4:85151505-85151527 TTCCTTCAGCAGCTGCAGCTTGG + Intergenic
980731039 4:136824317-136824339 CAGCTGCAGCCGCCCAAGCTGGG - Intergenic
981081883 4:140644613-140644635 CGCCTTCAGCCGCTCCAGCTGGG + Intronic
981430009 4:144646845-144646867 CCCACTCAGCAGCTCCAGCTGGG - Exonic
985450265 4:190057998-190058020 CACATCCAGCAGCACCATCTTGG + Intergenic
986280937 5:6321854-6321876 CACCTGCAGCTGCCCCTGCCAGG + Intergenic
987968244 5:24905400-24905422 CACTTTCAGCAGACCTTGCTGGG - Intergenic
988155862 5:27448230-27448252 CAATTTCAGCAGCTCCAGATGGG + Intergenic
990527195 5:56639592-56639614 AACCTTCAGCCTCTCCAGCTGGG + Intergenic
991198478 5:63961926-63961948 CGCGTTCAGAAGCTCCAGCTGGG + Exonic
992160681 5:73997858-73997880 CACAGACAGCGGCCCCAGCTGGG + Intergenic
992269486 5:75051219-75051241 CACCTTCAGTCTCCCCAGCAAGG + Intergenic
992957373 5:81923714-81923736 CACTTTCAGCAGCCTCACCAAGG - Intergenic
997236409 5:132274666-132274688 CAACTACAGCAGCCCCTGCCTGG + Intronic
997376939 5:133404016-133404038 CAACTTCAGCAGCCACAGGTTGG - Intronic
997423290 5:133786062-133786084 AAACTTCAGCATCCCCAACTGGG + Intergenic
997593039 5:135087190-135087212 CACCTGGACCAGCCCCACCTGGG + Intronic
998040309 5:138947247-138947269 TACCGTCAGGACCCCCAGCTCGG - Exonic
998250508 5:140549029-140549051 CTCCTTCAGCTCCTCCAGCTTGG - Exonic
999673212 5:153975319-153975341 CCCCTTCCCCAGACCCAGCTAGG + Intergenic
1000231980 5:159324438-159324460 CACCATCAGCAGCATCACCTTGG + Intronic
1001748521 5:174110404-174110426 CAGCCTGTGCAGCCCCAGCTGGG - Intronic
1002430608 5:179201909-179201931 CCACTCCAGCAGCCCCTGCTGGG - Intronic
1002443187 5:179274808-179274830 CACCTCCACCAGCCCCTGCCTGG - Intronic
1002855559 6:1034893-1034915 CTCCTTCTGCAGCACCAGTTTGG + Intergenic
1002942931 6:1733699-1733721 CACCACCACCAGGCCCAGCTGGG - Intronic
1003995526 6:11537263-11537285 CGAGTTCAGCAGCCCCACCTTGG + Intergenic
1004696958 6:18042857-18042879 CACCCTCAGCAGCCCCAGGAAGG + Intergenic
1006272934 6:32978242-32978264 CATCTTCATCGGCCCCAGCTCGG - Exonic
1006393745 6:33773654-33773676 CCTATTCAGCAGCCCCAACTTGG + Intronic
1007219325 6:40265960-40265982 CACCTTCACCAGAGGCAGCTGGG - Intergenic
1007697368 6:43742466-43742488 CTCCTTCAGCAGCCCCCACCTGG + Intergenic
1007783676 6:44268447-44268469 CACCTCCACCCACCCCAGCTAGG + Intergenic
1007784756 6:44273200-44273222 CACCTTCAGCAGCGCCTACCAGG + Exonic
1009736833 6:67687548-67687570 CACCTTCAGGGGCTGCAGCTGGG + Intergenic
1011610502 6:89146197-89146219 CAGCTTCAGTAGCTCCAGCTCGG - Exonic
1013548904 6:111187930-111187952 CACCTTCAGCAGCCCATTCCTGG - Intronic
1014253601 6:119139985-119140007 CACCCTGGGCAGCCCCAGCAAGG - Intronic
1014283627 6:119469290-119469312 GAACTGCAGGAGCCCCAGCTGGG - Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1017287230 6:152690010-152690032 CACTTTCAGAAGCCACAGCGTGG + Intergenic
1017551904 6:155518318-155518340 CACCTTAAGCAGTGCCAGCTGGG - Intergenic
1018716721 6:166538692-166538714 AACCTTCAGCAGCTCAAACTGGG + Exonic
1018834098 6:167470532-167470554 CACCCACAGCAGCCCTGGCTGGG - Intergenic
1018867727 6:167758898-167758920 CTGCTTCTGCGGCCCCAGCTTGG + Intergenic
1018984336 6:168624981-168625003 CACCACCAGCAGCACCATCTGGG + Intronic
1019166931 6:170103269-170103291 CACCTCCATCAGGCCCAGCCAGG + Intergenic
1019723130 7:2585669-2585691 CACCTGGGTCAGCCCCAGCTGGG + Intronic
1022285173 7:28949774-28949796 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1022484510 7:30767936-30767958 CACAGACAGTAGCCCCAGCTGGG + Intronic
1022495421 7:30850214-30850236 CTCCTTCACCAGCCCCACCCAGG + Intronic
1023192901 7:37601849-37601871 CACCTTCAGCAGCCCCAAGTGGG + Intergenic
1023361913 7:39426035-39426057 CGCCGTTAGCAGCCCCAACTGGG + Intronic
1023418216 7:39951099-39951121 CCCCAGCAGCAGCCCCTGCTCGG - Exonic
1026459571 7:70601793-70601815 GACCTTCACCAGCCTCAGCAAGG + Intronic
1026824188 7:73571033-73571055 CAACTTGAGCAGCTCCAGCTAGG + Intronic
1027929069 7:84507707-84507729 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1029111131 7:98213520-98213542 CACATCCAGGAGCCCCAACTTGG - Intergenic
1029335597 7:99896865-99896887 CAACTGCAGCTGCCACAGCTTGG - Intronic
1029574897 7:101396933-101396955 CTCCTTCAGCAGCCCAGGCCTGG + Intronic
1029611435 7:101628646-101628668 CAGCCCCAGCAGCCCCAGCTCGG + Intronic
1031514369 7:122683766-122683788 CACAGACAGCAGCCCCAACTGGG - Intronic
1032395753 7:131588541-131588563 CACCTTCCCCAGCCCCTCCTAGG + Intergenic
1035335119 7:158123005-158123027 CAGCTTCACCAGCCCGATCTGGG + Intronic
1035434625 7:158850134-158850156 CACCTTCAGGGGCCCCAGAAAGG - Intergenic
1035675411 8:1452398-1452420 CAGGTTCATCAGCCCCAGCTGGG + Intergenic
1036076626 8:5509143-5509165 CAACGTCAGCAACCTCAGCTGGG - Intergenic
1036418001 8:8568247-8568269 CACCTTGTTCAGCCTCAGCTGGG + Intergenic
1036463988 8:8979157-8979179 GACATTCAGCAGCTCCAGCCCGG + Intergenic
1036727379 8:11231856-11231878 CAATCTCAGCACCCCCAGCTCGG + Intergenic
1039081022 8:33734109-33734131 CACCTTCTCCAGCCGTAGCTAGG + Intergenic
1039435522 8:37556884-37556906 GCCCTTCACCAGCACCAGCTGGG - Intergenic
1040673894 8:49725655-49725677 CCCTCTCAGCAACCCCAGCTGGG - Intergenic
1042751543 8:72163050-72163072 CTGCCTTAGCAGCCCCAGCTAGG - Intergenic
1046989763 8:120439149-120439171 CACCTTGTTCAGCCTCAGCTGGG - Intronic
1048796172 8:138152119-138152141 CATCTTCAGCAGCCTCCTCTGGG + Exonic
1048986821 8:139739193-139739215 CACCGGCAGCAGCTCAAGCTGGG + Intronic
1049020985 8:139957603-139957625 CACCTCCAGCTGTCCAAGCTTGG + Intronic
1049495795 8:142931783-142931805 CATCTTCAGGAGCCCCAAATAGG - Intergenic
1049572675 8:143376584-143376606 CTCCTTCAGCAGCTGCAGGTTGG - Exonic
1049608493 8:143541143-143541165 CACCCTCTGCAGCCCCAGCAGGG + Intronic
1049813825 8:144588742-144588764 AAGCCTCAGCAGCCTCAGCTGGG + Intronic
1050051492 9:1606897-1606919 CAGCTTCTGCAGCCCTAGCTGGG + Intergenic
1050287435 9:4118057-4118079 CACCTTCACCACCCGGAGCTCGG - Exonic
1056322849 9:85452639-85452661 GACCTTCAGCTTCCCCAGTTGGG + Intergenic
1056461703 9:86815165-86815187 CTACTTCCCCAGCCCCAGCTTGG - Intergenic
1057282044 9:93720202-93720224 CACCTTCCACAGCCCCAGGAGGG + Intergenic
1059180438 9:112207304-112207326 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1059419246 9:114180862-114180884 CACCTTCAGAAGCTGCAGATGGG + Intronic
1060290730 9:122300144-122300166 CCCCTACAGCAGCCCCATTTGGG + Intronic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1061188540 9:129069110-129069132 CACCATCAGCAGCCTCCTCTTGG - Exonic
1061550358 9:131331106-131331128 CACCTTCACCAGCCACATCCAGG + Intergenic
1061927853 9:133814856-133814878 GACCTGCAGCAGCCCGGGCTGGG - Intronic
1062057805 9:134477638-134477660 CACCCACAGCAACTCCAGCTGGG + Intergenic
1062107648 9:134764429-134764451 CACCTGAATCAGCCCGAGCTTGG + Intronic
1062390616 9:136332257-136332279 CACCTGCAGCTGCACCAGGTGGG - Intronic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1062503841 9:136862830-136862852 CACTCTCACCAACCCCAGCTGGG + Intronic
1062576230 9:137209688-137209710 CACCTACAGCATCCTCAGCAAGG - Intronic
1062622953 9:137430826-137430848 CGCCCTCAGCAGCCACAGGTGGG + Exonic
1062623638 9:137433576-137433598 CTCCCTCACCAGGCCCAGCTTGG + Exonic
1186496065 X:10014260-10014282 GAGCTTCAGCTTCCCCAGCTGGG + Intergenic
1190020634 X:46870676-46870698 CACCTTGTTCAGCCTCAGCTGGG + Intronic
1190916210 X:54812959-54812981 CACCATGAGCAGACCCAGCTTGG - Exonic
1190928079 X:54926424-54926446 CACCATGAGGAGACCCAGCTTGG - Exonic
1198364617 X:135928234-135928256 TTCCTTCAGCAGCCACAGCCTGG + Intergenic
1199601484 X:149543877-149543899 CATGCTCAGCAGCCCCAGCATGG - Intronic
1199648893 X:149935607-149935629 CATGCTCAGCAGCCCCAGCATGG + Intronic
1201413914 Y:13728616-13728638 CACCTTCAGTAGCCCCAAAGTGG - Intergenic