ID: 928687044

View in Genome Browser
Species Human (GRCh38)
Location 2:33760498-33760520
Sequence ATGGCTACACCGAACTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928687038_928687044 6 Left 928687038 2:33760469-33760491 CCAACATTTCCTTGCCCAGATTT No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687043_928687044 -9 Left 928687043 2:33760484-33760506 CCAGATTTGGTCAGATGGCTACA No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687036_928687044 17 Left 928687036 2:33760458-33760480 CCATTCCTTCTCCAACATTTCCT No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687040_928687044 -3 Left 928687040 2:33760478-33760500 CCTTGCCCAGATTTGGTCAGATG No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687042_928687044 -8 Left 928687042 2:33760483-33760505 CCCAGATTTGGTCAGATGGCTAC No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687037_928687044 12 Left 928687037 2:33760463-33760485 CCTTCTCCAACATTTCCTTGCCC No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data
928687035_928687044 30 Left 928687035 2:33760445-33760467 CCAGAAATTGCATCCATTCCTTC No data
Right 928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928687044 Original CRISPR ATGGCTACACCGAACTACAA AGG Intergenic
No off target data available for this crispr