ID: 928690157 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:33791191-33791213 |
| Sequence | CAATTTATGGAGATGGAGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928690157_928690164 | -6 | Left | 928690157 | 2:33791191-33791213 | CCCCCCTCCATCTCCATAAATTG | No data | ||
| Right | 928690164 | 2:33791208-33791230 | AAATTGTCAAATTGTTGTAGAGG | No data | ||||
| 928690157_928690165 | -1 | Left | 928690157 | 2:33791191-33791213 | CCCCCCTCCATCTCCATAAATTG | No data | ||
| Right | 928690165 | 2:33791213-33791235 | GTCAAATTGTTGTAGAGGCTAGG | No data | ||||
| 928690157_928690166 | 0 | Left | 928690157 | 2:33791191-33791213 | CCCCCCTCCATCTCCATAAATTG | No data | ||
| Right | 928690166 | 2:33791214-33791236 | TCAAATTGTTGTAGAGGCTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928690157 | Original CRISPR | CAATTTATGGAGATGGAGGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||