ID: 928690157

View in Genome Browser
Species Human (GRCh38)
Location 2:33791191-33791213
Sequence CAATTTATGGAGATGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928690157_928690164 -6 Left 928690157 2:33791191-33791213 CCCCCCTCCATCTCCATAAATTG No data
Right 928690164 2:33791208-33791230 AAATTGTCAAATTGTTGTAGAGG No data
928690157_928690165 -1 Left 928690157 2:33791191-33791213 CCCCCCTCCATCTCCATAAATTG No data
Right 928690165 2:33791213-33791235 GTCAAATTGTTGTAGAGGCTAGG No data
928690157_928690166 0 Left 928690157 2:33791191-33791213 CCCCCCTCCATCTCCATAAATTG No data
Right 928690166 2:33791214-33791236 TCAAATTGTTGTAGAGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928690157 Original CRISPR CAATTTATGGAGATGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr