ID: 928694952

View in Genome Browser
Species Human (GRCh38)
Location 2:33840233-33840255
Sequence GCAGCCAATGTGGGTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928694952_928694957 4 Left 928694952 2:33840233-33840255 CCAGCTTTACCCACATTGGCTGC 0: 1
1: 1
2: 3
3: 13
4: 144
Right 928694957 2:33840260-33840282 CGGGTAAGAGCAAAATCAAGAGG 0: 1
1: 0
2: 2
3: 9
4: 135
928694952_928694958 5 Left 928694952 2:33840233-33840255 CCAGCTTTACCCACATTGGCTGC 0: 1
1: 1
2: 3
3: 13
4: 144
Right 928694958 2:33840261-33840283 GGGTAAGAGCAAAATCAAGAGGG 0: 1
1: 0
2: 3
3: 64
4: 461
928694952_928694959 21 Left 928694952 2:33840233-33840255 CCAGCTTTACCCACATTGGCTGC 0: 1
1: 1
2: 3
3: 13
4: 144
Right 928694959 2:33840277-33840299 AAGAGGGTACACAAAACACAAGG 0: 5
1: 1
2: 3
3: 15
4: 280
928694952_928694960 27 Left 928694952 2:33840233-33840255 CCAGCTTTACCCACATTGGCTGC 0: 1
1: 1
2: 3
3: 13
4: 144
Right 928694960 2:33840283-33840305 GTACACAAAACACAAGGATGTGG 0: 4
1: 4
2: 5
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928694952 Original CRISPR GCAGCCAATGTGGGTAAAGC TGG (reversed) Intergenic
902471577 1:16650096-16650118 CCAGCAGTTGTGGGTAAAGCAGG - Intergenic
902487232 1:16757349-16757371 CCAGCAGTTGTGGGTAAAGCAGG + Intronic
902544619 1:17182159-17182181 GCAGCCACTTTGGGAAACGCCGG - Intergenic
903511616 1:23879976-23879998 GAAGCCAATGTGGCTAAAGCTGG - Intronic
904925274 1:34042775-34042797 GAAGCCAGTGTGGGTAGAGGGGG - Intronic
905208931 1:36359928-36359950 GCAGCAACTGTGGGGAAAGCTGG - Intronic
907334461 1:53691243-53691265 GCTCCCACTGTGGGTACAGCTGG - Intronic
907334691 1:53692609-53692631 TCAGCCACTGTGGGTGTAGCTGG + Intronic
907635866 1:56134285-56134307 GCAGCCCATGAGGGGAAAGAAGG + Intergenic
911681330 1:100719427-100719449 GAATCCAATGTGGGTTAAGGGGG - Intergenic
912562629 1:110561511-110561533 GCAGCCAATGAGGGAGAAGAGGG + Intergenic
913595501 1:120372137-120372159 GCAGCAAAGGTGGGCAAAGAGGG - Intergenic
914091775 1:144506838-144506860 GCAGCAAAGGTGGGCAAAGAGGG + Intergenic
914306766 1:146427026-146427048 GCAGCAAAGGTGGGCAAAGAGGG - Intergenic
914595283 1:149145776-149145798 GCAGCAAAGGTGGGCAAAGAGGG + Intergenic
915017303 1:152745973-152745995 GCAGCCAGTGTGGTAACAGCGGG - Intronic
917761628 1:178166010-178166032 GCAGTGAAGGTGGGTAAAGTGGG - Intronic
918169980 1:181987293-181987315 GGAGCTAAGGTGGGGAAAGCAGG - Intergenic
923234748 1:232021696-232021718 GCAGCCATAGTAGGTAAAACAGG - Intronic
1063579953 10:7297314-7297336 ACAGCCAATGTGGTTGTAGCTGG - Intronic
1064534169 10:16341729-16341751 GCAGGCATTGTGGTTAAACCTGG - Intergenic
1065499580 10:26366310-26366332 GCAGTAAATGTGGGTAGAGGAGG - Intergenic
1068096872 10:52502316-52502338 GAAGCCAATGTTGTTAAAGATGG + Intergenic
1071250946 10:83818973-83818995 GCAGATAATGTGGAAAAAGCTGG - Intergenic
1071365584 10:84897248-84897270 GCAGGGAATGTGGGAAAGGCAGG - Intergenic
1081571417 11:44293811-44293833 GCAGCTCCTGTGGGTAAAGAAGG - Intronic
1082679727 11:56152849-56152871 GCAGCCACTGTAGGTAATGGGGG - Intergenic
1083327525 11:61880339-61880361 GCAGGCAATGGGTGAAAAGCAGG - Intronic
1084270194 11:68025235-68025257 ACTGCCATTGTGGGTAATGCTGG + Intronic
1085047944 11:73364112-73364134 GCAGCCAAAGTGGGTCACCCAGG - Intronic
1085056750 11:73409066-73409088 GCACACAATGGGGGTCAAGCAGG - Intronic
1087115833 11:94523178-94523200 GCAGGTAATATGAGTAAAGCTGG - Intergenic
1087589894 11:100173780-100173802 GCTGCCACTCTGGGTGAAGCTGG - Intronic
1090223423 11:125052075-125052097 GCAGCCAATGTAAGGAAAGAAGG - Intergenic
1091306585 11:134540157-134540179 GCAGCCAATGTGGGGGATGATGG - Intergenic
1095144135 12:38703946-38703968 GCAGCCAACTTGGATATAGCTGG + Intronic
1095948113 12:47765403-47765425 GCAGGCAAAGCGGCTAAAGCAGG - Intronic
1095954568 12:47798775-47798797 GGAGCCCATGAGGGTAAAGATGG - Exonic
1096860953 12:54527743-54527765 ACAGCCAATGTGGGTAGAGGAGG - Intronic
1098731413 12:74040228-74040250 GCTGCCAGTGTACGTAAAGCAGG + Intergenic
1098924559 12:76334906-76334928 TCAGTCACTGTGGGGAAAGCCGG + Intergenic
1101037803 12:100722248-100722270 GCAGCCAAAGTGGGCAATGATGG - Intronic
1102508207 12:113397337-113397359 GGAGACACTGTGGGAAAAGCCGG - Exonic
1103276831 12:119718812-119718834 GGAACCTGTGTGGGTAAAGCAGG + Exonic
1104834688 12:131781005-131781027 TATGCCAATGTGGGAAAAGCTGG - Intronic
1108111674 13:47080572-47080594 GTAGACAATGTGGAGAAAGCAGG - Intergenic
1109039578 13:57315162-57315184 CCAGTGGATGTGGGTAAAGCTGG + Intergenic
1120782918 14:88502121-88502143 GAAGGCAGTGTGGGTAAAGGAGG + Intronic
1122265999 14:100547160-100547182 ACAGCCATTTTGGGGAAAGCAGG - Intronic
1124847969 15:33310493-33310515 ACAGGCAAAGTGGGCAAAGCGGG + Intergenic
1125401991 15:39313732-39313754 GCAGTTAAGGTGGTTAAAGCAGG - Intergenic
1128291928 15:66484680-66484702 GTGGCCAAGCTGGGTAAAGCTGG + Intronic
1129510845 15:76120860-76120882 GCAGGTAATGTGGGGGAAGCAGG + Intronic
1129751186 15:78065676-78065698 GAAGCCAATGTGGGCAGAGGTGG - Intronic
1129959219 15:79668114-79668136 GCAGCCAATGTAGAAAATGCTGG + Intergenic
1130144857 15:81266288-81266310 AGAGGCAATGTTGGTAAAGCAGG - Intronic
1131092136 15:89631299-89631321 CCAGCCAATGAGGCCAAAGCAGG + Intronic
1132120827 15:99173843-99173865 GCAAGCAATGTGAGTGAAGCAGG - Intronic
1132231804 15:100189993-100190015 GCAGCCAATGAGAGGAAGGCAGG - Intronic
1133081336 16:3322959-3322981 GCAGCCAATGTAGAAAATGCTGG + Intergenic
1135006498 16:18828278-18828300 GCAGCCAATGGGAGGTAAGCAGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140577984 16:76195005-76195027 GCAGCCAACTTGAGTAAAGGGGG + Intergenic
1140799740 16:78475318-78475340 GCAGCCAATCTGGGTGAACAAGG - Intronic
1141502670 16:84454675-84454697 ACAGCTAATGTGGGTGAAGCTGG + Intronic
1141634983 16:85309851-85309873 GCAGCTGATGTGGTTACAGCTGG + Intergenic
1143328566 17:6117902-6117924 GCAGACAGATTGGGTAAAGCTGG - Intronic
1143977035 17:10837607-10837629 GCAGCCATTGTGGGAAGGGCTGG - Intronic
1146571154 17:33954407-33954429 GCAGCCAATATGCCTAAAGCTGG + Intronic
1146755521 17:35428946-35428968 GCAGCCTTTGTGGGTAGAGATGG - Intronic
1146788712 17:35739395-35739417 GCAGCCAGTGTGTGGAAAGAAGG - Intronic
1148679429 17:49465295-49465317 GCAGCCACTGAAGGAAAAGCTGG + Intronic
1149959661 17:61094062-61094084 GAAGCAATTGTGGGTAAAACTGG + Intronic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1151523705 17:74649110-74649132 GCAACGAATGGGGGAAAAGCTGG + Intergenic
1152233618 17:79127034-79127056 GCAGCCAGGATGGGCAAAGCTGG - Intronic
1154374622 18:13798870-13798892 GCAGCCACTGTGTGTGAAGAAGG - Intergenic
1156880205 18:42068610-42068632 TCAGCTAATGTGGGAAAAGTGGG - Intronic
1159508524 18:69365613-69365635 CTAGCCAATGTGAGTAATGCTGG + Intergenic
1162610307 19:11744662-11744684 ACAGCCAATGTGGGAGAAGACGG + Intergenic
1164195035 19:22949192-22949214 GCAGGCAATGTGTGTAAAAACGG + Intergenic
1165158762 19:33803699-33803721 GCAGCTAACGGGGGTCAAGCAGG - Intronic
1168517602 19:57021401-57021423 GAAGGAAATGTGGGAAAAGCAGG - Intergenic
1202703975 1_KI270713v1_random:6891-6913 CCAGCAGTTGTGGGTAAAGCAGG - Intergenic
925195977 2:1926121-1926143 GCAGCAAATGTGGGGACGGCGGG + Intronic
926212412 2:10880557-10880579 GCAGCCAGTGTGGGTTGGGCCGG + Intergenic
928694952 2:33840233-33840255 GCAGCCAATGTGGGTAAAGCTGG - Intergenic
930240681 2:48932851-48932873 GGAGCCTAGGTGGGGAAAGCAGG + Intergenic
933155396 2:78967511-78967533 ACAGCCATTGTGGGGAAAGCTGG + Intergenic
935256088 2:101310886-101310908 GCAGCCAGTGTAGGGAAAGAAGG - Intergenic
935515118 2:104026820-104026842 GCTGCCAGTGTGGGTGAAGCAGG - Intergenic
936783105 2:116057711-116057733 GAACCCTATGTGGGTAGAGCAGG + Intergenic
937500544 2:122473856-122473878 GCAGTCACTCTGGGGAAAGCTGG - Intergenic
937798971 2:126059392-126059414 GCAGCCACTGTGGGGAATGGAGG + Intergenic
938116681 2:128607108-128607130 GGGGCCAATGTGGTCAAAGCAGG - Intergenic
942765020 2:179444800-179444822 GCAGCCATTGTGGGCAAGGAGGG - Intronic
945170138 2:206987390-206987412 GCAGGCAATGTGGGAGAAGGTGG - Intergenic
946150210 2:217760317-217760339 GCAGCCAATGTAGAAAATGCTGG + Intergenic
947248008 2:228071480-228071502 GAAGCCAAAGAGTGTAAAGCCGG - Intronic
947745466 2:232504995-232505017 GCAGCAAATGTCCGGAAAGCAGG - Intergenic
1169186618 20:3622883-3622905 GCATCCAGTGTGGGTAAAGGCGG + Intronic
1170290558 20:14764183-14764205 GGACCCAATGTGGGGAAGGCGGG - Intronic
1173985423 20:47258115-47258137 TCCGACAATGTGGGTTAAGCTGG + Intronic
1176036185 20:63038164-63038186 TCAGCCATTGTGAGTAACGCTGG + Intergenic
1179268773 21:39831582-39831604 TCAACCAATGTGGGGAAGGCAGG - Intergenic
1179830554 21:43993619-43993641 GCGGCCAGTGGGGGCAAAGCAGG - Intergenic
1184050638 22:42001523-42001545 GCAGCTGATGTGGGCAAAGCTGG - Intronic
1184735515 22:46395478-46395500 GGAGCCAGTGTGGCTGAAGCGGG - Intronic
950595350 3:13975753-13975775 GAACCCACTGTGGCTAAAGCAGG + Intronic
951325862 3:21301283-21301305 GCAGCCACTGTGGGGATAGGTGG - Intergenic
953136242 3:40184498-40184520 ACAGCCAATGTAGGCAGAGCTGG + Intronic
953257040 3:41301035-41301057 GCAGCCCATGTGGATGGAGCAGG + Intronic
953537183 3:43785332-43785354 TCAGCAAATGTGGGGGAAGCAGG + Intergenic
953778585 3:45844652-45844674 GCAGCCAAGGTGGGGCAAGATGG - Intronic
954297846 3:49684145-49684167 CCAGCAGTTGTGGGTAAAGCAGG + Exonic
954362146 3:50127559-50127581 GCAGCCAGTGTGGGGTAAACAGG + Intergenic
954440085 3:50516971-50516993 TCAGCCTCTGTGGGGAAAGCTGG + Intergenic
956769865 3:72516154-72516176 GAAGCCAACGTGGGGAAAGAAGG - Intergenic
958096504 3:88952421-88952443 GCAGCCATAGTGGGAAAATCAGG + Intergenic
958977051 3:100680280-100680302 GCAATCAATGTGCATAAAGCTGG - Intronic
959215652 3:103447569-103447591 GCAGCCACTGTTGGGGAAGCAGG - Intergenic
966678161 3:182611617-182611639 GCAGCCAATGTGGAAAACGCTGG - Intergenic
970219482 4:13796153-13796175 GCAGAACATGTGGATAAAGCTGG + Intergenic
972680844 4:41305604-41305626 GCAGCTAATGGGGATAGAGCAGG - Intergenic
976232813 4:82863140-82863162 GCAACCACTGTGGGTAATGATGG + Intronic
977762751 4:100759167-100759189 TCAGCCACTGTGGGGAAGGCGGG - Intronic
978597947 4:110399233-110399255 GCAGCCAATGTAGAAAACGCTGG + Intronic
979600604 4:122583217-122583239 CCAGCAAACGTGGGAAAAGCAGG + Intergenic
980705177 4:136483920-136483942 GCGGCCATTTTGAGTAAAGCAGG - Intergenic
985087548 4:186329160-186329182 GCAGCTGATGTGGGTAAAGCTGG - Intergenic
985516519 5:348077-348099 GCAGCTGATGTGGGGGAAGCCGG + Intronic
987319045 5:16750525-16750547 GCAGCCAGGGCGGGTAAAGGGGG + Intronic
993287078 5:86013059-86013081 TGAGCCAATATGGATAAAGCCGG + Intergenic
993993714 5:94692749-94692771 GCAGCCAATTAAGTTAAAGCAGG + Intronic
997237161 5:132279388-132279410 GCAGCCATTGTCAGTGAAGCTGG - Intronic
997713728 5:136027451-136027473 GCATCCCATGAGGATAAAGCTGG - Intergenic
1000468070 5:161604962-161604984 AAAGCCAATGTGAGGAAAGCGGG - Intronic
1001702594 5:173718111-173718133 GCAGCAAAGGTGGCGAAAGCGGG + Intergenic
1001892642 5:175352008-175352030 GCAGCCAGTGAGGGCAGAGCTGG + Intergenic
1003153202 6:3570139-3570161 GCAGCAGATGTGGGTAGAGCAGG - Intergenic
1012153383 6:95784250-95784272 GCTGGCTAAGTGGGTAAAGCTGG + Intergenic
1012321602 6:97854320-97854342 GAAAAGAATGTGGGTAAAGCAGG + Intergenic
1014457589 6:121654203-121654225 GCAGCCGATGTGGGTAAAGCTGG + Intergenic
1021828352 7:24576382-24576404 GCAGCCAATGTATGTAAAGAAGG - Intronic
1022672803 7:32471936-32471958 GCAGCTGACGTGGGTAAAGCTGG + Intergenic
1028480722 7:91301655-91301677 GAGGCCAATGTGGCTAGAGCAGG - Intergenic
1029495170 7:100892635-100892657 GCAGCCAGTCTGTGTAATGCAGG + Exonic
1031115658 7:117665694-117665716 GCAGCTATTTTGAGTAAAGCTGG - Intronic
1033057543 7:138073032-138073054 GCTGCTCAAGTGGGTAAAGCAGG + Intronic
1040019127 8:42724670-42724692 GCAGCCAATGTAGAAAACGCTGG + Intronic
1043666742 8:82825077-82825099 GCAGCCACTGTGGGGACAACAGG + Intergenic
1044733007 8:95247232-95247254 GCAGTTAAAGTGGATAAAGCCGG - Exonic
1045426202 8:102068240-102068262 GCAGCCAAGGAGGGTTAAGTGGG - Intronic
1052735094 9:32333909-32333931 GCAGCCGATGTGGGTAGACCTGG - Intergenic
1059416648 9:114166681-114166703 GCTGCCAGTGTTGGCAAAGCAGG - Intronic
1061890339 9:133615898-133615920 ACAGCCAGTCTGGGTATAGCTGG - Intergenic
1185702723 X:2243224-2243246 GCAGGCACTGTGGGGCAAGCAGG + Exonic
1186458855 X:9732406-9732428 GCTGCAATTGTGGGAAAAGCAGG + Intronic
1189334792 X:40164593-40164615 GCAGCCAATGTAGGTCAGGAGGG - Intronic
1190140606 X:47840392-47840414 GCAGCCAATGTAGAAAATGCTGG + Intronic
1193627167 X:83836095-83836117 GCAGCCATTGTGGCCAAATCAGG - Intergenic
1196791753 X:119469973-119469995 GCAGCTGATGTGGGTAAAGCTGG + Exonic