ID: 928696096

View in Genome Browser
Species Human (GRCh38)
Location 2:33851693-33851715
Sequence CGTGCAGGTCCTTCTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928696096_928696103 1 Left 928696096 2:33851693-33851715 CCCCAGGGAGAAGGACCTGCACG No data
Right 928696103 2:33851717-33851739 AGCTGGAAAATAGGCTACATTGG No data
928696096_928696102 -8 Left 928696096 2:33851693-33851715 CCCCAGGGAGAAGGACCTGCACG No data
Right 928696102 2:33851708-33851730 CCTGCACGGAGCTGGAAAATAGG No data
928696096_928696104 6 Left 928696096 2:33851693-33851715 CCCCAGGGAGAAGGACCTGCACG No data
Right 928696104 2:33851722-33851744 GAAAATAGGCTACATTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928696096 Original CRISPR CGTGCAGGTCCTTCTCCCTG GGG (reversed) Intergenic
No off target data available for this crispr