ID: 928696491

View in Genome Browser
Species Human (GRCh38)
Location 2:33854921-33854943
Sequence TCAATTAAACCATTACTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928696491_928696501 20 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696501 2:33854964-33854986 GGTGGGGGATAAAGGCATGAAGG No data
928696491_928696493 -3 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696493 2:33854941-33854963 TGAATACTGTTGTTTAAAATGGG No data
928696491_928696492 -4 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696492 2:33854940-33854962 TTGAATACTGTTGTTTAAAATGG No data
928696491_928696503 25 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696503 2:33854969-33854991 GGGATAAAGGCATGAAGGGCTGG No data
928696491_928696498 4 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696498 2:33854948-33854970 TGTTGTTTAAAATGGGGGTGGGG No data
928696491_928696496 2 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696496 2:33854946-33854968 ACTGTTGTTTAAAATGGGGGTGG No data
928696491_928696502 21 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696502 2:33854965-33854987 GTGGGGGATAAAGGCATGAAGGG No data
928696491_928696494 -2 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696494 2:33854942-33854964 GAATACTGTTGTTTAAAATGGGG No data
928696491_928696500 12 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696500 2:33854956-33854978 AAAATGGGGGTGGGGGATAAAGG No data
928696491_928696495 -1 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696495 2:33854943-33854965 AATACTGTTGTTTAAAATGGGGG No data
928696491_928696497 3 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696497 2:33854947-33854969 CTGTTGTTTAAAATGGGGGTGGG No data
928696491_928696499 5 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696499 2:33854949-33854971 GTTGTTTAAAATGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928696491 Original CRISPR TCAATTAAACCATTACTTTG AGG (reversed) Intergenic
No off target data available for this crispr