ID: 928696502

View in Genome Browser
Species Human (GRCh38)
Location 2:33854965-33854987
Sequence GTGGGGGATAAAGGCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928696491_928696502 21 Left 928696491 2:33854921-33854943 CCTCAAAGTAATGGTTTAATTGA No data
Right 928696502 2:33854965-33854987 GTGGGGGATAAAGGCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928696502 Original CRISPR GTGGGGGATAAAGGCATGAA GGG Intergenic
No off target data available for this crispr