ID: 928698454

View in Genome Browser
Species Human (GRCh38)
Location 2:33874121-33874143
Sequence CTAGGTTTCCCTAGGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928698454_928698460 -2 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698460 2:33874142-33874164 AGGAAACCATTCATCATCCTGGG No data
928698454_928698465 7 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698465 2:33874151-33874173 TTCATCATCCTGGGGGAACTGGG No data
928698454_928698464 6 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698464 2:33874150-33874172 ATTCATCATCCTGGGGGAACTGG No data
928698454_928698462 0 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698462 2:33874144-33874166 GAAACCATTCATCATCCTGGGGG No data
928698454_928698466 8 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698466 2:33874152-33874174 TCATCATCCTGGGGGAACTGGGG No data
928698454_928698461 -1 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698461 2:33874143-33874165 GGAAACCATTCATCATCCTGGGG No data
928698454_928698459 -3 Left 928698454 2:33874121-33874143 CCCGCTTTCCTAGGGAAACCTAG No data
Right 928698459 2:33874141-33874163 TAGGAAACCATTCATCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928698454 Original CRISPR CTAGGTTTCCCTAGGAAAGC GGG (reversed) Intergenic
No off target data available for this crispr