ID: 928700713

View in Genome Browser
Species Human (GRCh38)
Location 2:33895967-33895989
Sequence CCTTATAAGAGGATAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928700708_928700713 17 Left 928700708 2:33895927-33895949 CCTGGAGCATTTGAGTGGCTCTA No data
Right 928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928700713 Original CRISPR CCTTATAAGAGGATAATGGA AGG Intergenic
No off target data available for this crispr