ID: 928712156

View in Genome Browser
Species Human (GRCh38)
Location 2:34019261-34019283
Sequence ACTGCAGGCGGGGATCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928712156_928712161 -9 Left 928712156 2:34019261-34019283 CCTCCATGATCCCCGCCTGCAGT No data
Right 928712161 2:34019275-34019297 GCCTGCAGTGTTCATGCCTTTGG No data
928712156_928712164 18 Left 928712156 2:34019261-34019283 CCTCCATGATCCCCGCCTGCAGT No data
Right 928712164 2:34019302-34019324 TCCCCTTCTTTGAGTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928712156 Original CRISPR ACTGCAGGCGGGGATCATGG AGG (reversed) Intergenic
No off target data available for this crispr