ID: 928712300

View in Genome Browser
Species Human (GRCh38)
Location 2:34020733-34020755
Sequence ATCAACTTTCTATAATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928712300_928712304 17 Left 928712300 2:34020733-34020755 CCACAGAATTATAGAAAGTTGAT No data
Right 928712304 2:34020773-34020795 AACAATAAAATACTAATGATGGG No data
928712300_928712303 16 Left 928712300 2:34020733-34020755 CCACAGAATTATAGAAAGTTGAT No data
Right 928712303 2:34020772-34020794 CAACAATAAAATACTAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928712300 Original CRISPR ATCAACTTTCTATAATTCTG TGG (reversed) Intergenic
No off target data available for this crispr