ID: 928713404

View in Genome Browser
Species Human (GRCh38)
Location 2:34032787-34032809
Sequence ACGTAACTCAAAAGGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928713404_928713409 4 Left 928713404 2:34032787-34032809 CCTTTGCCCCTTTTGAGTTACGT No data
Right 928713409 2:34032814-34032836 TTCAGAATTCCAAGTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928713404 Original CRISPR ACGTAACTCAAAAGGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr