ID: 928718936

View in Genome Browser
Species Human (GRCh38)
Location 2:34096929-34096951
Sequence TACCCAGGTCAAGAACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928718936_928718937 -10 Left 928718936 2:34096929-34096951 CCACTTTGTTCTTGACCTGGGTA No data
Right 928718937 2:34096942-34096964 GACCTGGGTATAAATAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928718936 Original CRISPR TACCCAGGTCAAGAACAAAG TGG (reversed) Intergenic
No off target data available for this crispr