ID: 928730564

View in Genome Browser
Species Human (GRCh38)
Location 2:34227016-34227038
Sequence CACTGGAGTCAGTTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928730564_928730568 1 Left 928730564 2:34227016-34227038 CCTGGGGAAAACTGACTCCAGTG No data
Right 928730568 2:34227040-34227062 TTTTCTTTAGCACAGCTGCAGGG No data
928730564_928730567 0 Left 928730564 2:34227016-34227038 CCTGGGGAAAACTGACTCCAGTG No data
Right 928730567 2:34227039-34227061 GTTTTCTTTAGCACAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928730564 Original CRISPR CACTGGAGTCAGTTTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr