ID: 928734788

View in Genome Browser
Species Human (GRCh38)
Location 2:34275598-34275620
Sequence CTGGATGCCTACTTTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928734788_928734793 13 Left 928734788 2:34275598-34275620 CCTGGCCTAAAGTAGGCATCCAG No data
Right 928734793 2:34275634-34275656 TTTGTTAGTATTGTCACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928734788 Original CRISPR CTGGATGCCTACTTTAGGCC AGG (reversed) Intergenic
No off target data available for this crispr