ID: 928749955

View in Genome Browser
Species Human (GRCh38)
Location 2:34459402-34459424
Sequence CACAGGAATGGGGTTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928749947_928749955 18 Left 928749947 2:34459361-34459383 CCAGATCATGAAAGCAGTCACAG No data
Right 928749955 2:34459402-34459424 CACAGGAATGGGGTTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928749955 Original CRISPR CACAGGAATGGGGTTTCCCA AGG Intergenic
No off target data available for this crispr