ID: 928753781

View in Genome Browser
Species Human (GRCh38)
Location 2:34500152-34500174
Sequence CCACAGAGAAGATGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928753775_928753781 27 Left 928753775 2:34500102-34500124 CCAGCAGAATTAGGAGTTTATCT No data
Right 928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928753781 Original CRISPR CCACAGAGAAGATGGGAAAT TGG Intergenic
No off target data available for this crispr