ID: 928757505

View in Genome Browser
Species Human (GRCh38)
Location 2:34545104-34545126
Sequence GTCTGATGACCTCTGTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928757502_928757505 3 Left 928757502 2:34545078-34545100 CCAGTAGGAATGCTCCTATATGA No data
Right 928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG No data
928757501_928757505 10 Left 928757501 2:34545071-34545093 CCTGATGCCAGTAGGAATGCTCC No data
Right 928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG No data
928757500_928757505 14 Left 928757500 2:34545067-34545089 CCGACCTGATGCCAGTAGGAATG No data
Right 928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG No data
928757498_928757505 26 Left 928757498 2:34545055-34545077 CCTTGAGGGGCACCGACCTGATG No data
Right 928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928757505 Original CRISPR GTCTGATGACCTCTGTTGTA GGG Intergenic
No off target data available for this crispr