ID: 928787058

View in Genome Browser
Species Human (GRCh38)
Location 2:34900852-34900874
Sequence TATCTTGTGGTGTAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928787058_928787060 -10 Left 928787058 2:34900852-34900874 CCACTTTCTTACACCACAAGATA No data
Right 928787060 2:34900865-34900887 CCACAAGATACACTCTATTTAGG No data
928787058_928787061 -9 Left 928787058 2:34900852-34900874 CCACTTTCTTACACCACAAGATA No data
Right 928787061 2:34900866-34900888 CACAAGATACACTCTATTTAGGG No data
928787058_928787062 25 Left 928787058 2:34900852-34900874 CCACTTTCTTACACCACAAGATA No data
Right 928787062 2:34900900-34900922 AGATATTTTGTGAAAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928787058 Original CRISPR TATCTTGTGGTGTAAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr