ID: 928791946

View in Genome Browser
Species Human (GRCh38)
Location 2:34967973-34967995
Sequence TTATATATGAATAAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928791946_928791949 25 Left 928791946 2:34967973-34967995 CCATTTTCTTTATTCATATATAA No data
Right 928791949 2:34968021-34968043 ATCATGAGATTACAGCAATTCGG No data
928791946_928791947 -8 Left 928791946 2:34967973-34967995 CCATTTTCTTTATTCATATATAA No data
Right 928791947 2:34967988-34968010 ATATATAAATAACTCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928791946 Original CRISPR TTATATATGAATAAAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr